TTHERM_00314870

Length: 609 bp

cDNA Sequence

ATGAAGCTTATAGCAATATTATGTGCTTGCAAAAATTCTACTGATAAGTAGGTATATATACCAATTAGAGAATATGAAGATAGTTCAATTAGTGTTTTTTAAAGAGGAAAAGTTAGAAATTTATTTAAATTCATTGTTAGTGAATCTTTTGTGGGCATTCAAAAGGGTACAAGGCACGAAGTAAGACATGAAGATTATCATATTTATATTCTCTCTTCTTTAACTCATGATGTTGTTGCATACGCATTCACATAAGGAGAATATCCTAGAAGAGTCATATACAAAGGCTTAGAAAAAGTTCTTGATGGATTTTTTTCTTAGCTAGCAATTGGTTACTAAGGAATAAAATCAGATGAAAAGATAAAAATACTTGCCATATAGTAAATTCTCAAAGATTATTCAGATCCTGCTAACGTAGATTAGTTAACTAAAGTCCTGAATAAAGTAAATGAAATATAAGTTATACTTCATGAAGATATATAAAAGTTGCTTGAAGCACAAGGCGATTTGGGTATTCTAGTAGAAAAATCCAAGTATCTTGATAATGCAGCAAAATAATTATACAAAAATTCTAAGAAAGTAGATAAAAATTGCTGCAGTATCTTTTGA