TTHERM_00316040

Length: 723 bp

cDNA Sequence

ATGAGTTCACAAGATAGTAGAATAAGTGACGAAGAGTTCGAAAGAAGATTAAATGCAAAAAGCTATAATACTACTTATAGAGCTCCTGATGAGCAAAATGTATAAAAGGATAAATATATCGATGATTGGTTTAAAAGCTAGAGATAATAAAGTGGATAGACTCTTTTAAATGAAATAAAAGAATTTGAAGAATAGAAATAATTGTAGAATTTTACTTAGCAATAAACGGGAGCAACTTAAGCACTACCTCCTAATGCTATCAACAGCTAGCAAAGCAAATTCTTTAATGAAACTAAAATTTTATTCCCAAAAGAATTGAAATTTGAAAACTTTTTAAATGATAAATATGCATCGTTTTATTACTTCTCACATCACCCAAAAACTAGCAATAAATTCGAAATCAGCGACATAGATACCTCTGATAGATTACTCAAATCTAGAAATACTGGATATCTCACTACATGGCTTTCAATATCACTAGTTTCCTACTATATGACAAAATATCTCAAACACTCCAATATTCCTTGGGGAATTACTTATAAATTTACTTTTATTGGATTCTTAGCTAAATACTTATTCTTTCCATCAGTAATGTCAAGTACTATTGATAAATATTTATTAGCTGCACCATTTGAAAAAAGACTAGATTAAATAATTTAAAAATATTCATTATCATCAGATCCTCTTTTTAGAGAAGTATTTGAATCATAACAAAAGAAATGA