TTHERM_00316430

Length: 1035 bp

cDNA Sequence

ATGTATAACTCTAAATCTTCTAAACTTAACTACTAACCTAGGGATACAGACATTACAAAATATAATTCCAAAATATTATATTAAAATTAGGGAAGGAAATAAGTCGAGCAATAAAATAACTAACAACTGGTTAACCAAAATTAGGGAATTAAGATAGTCAGGACTAACTAATCGAAAGATACATTTAGAACATTAGATCCTTAAAAAATTGAAAAGGAACAACCATTGTTCTAGCATAAAAAGCAAGTTAATGTAGACTATCCTGCATCTTCACAAAACATTTTTGGGCATTACTACAACTAAGAGAATAATAATTAGTAAACAACTTTAAGGGCAAATAGATCTAGTACTGCTTTGATTTCTAATAAAAGCCCTAATAGATCTTAACCTTTAAATTTATTTGCTCCAGACACCAATCCTCCAGTTTATTCAACATTGAATGTAAACTCAACTTCTTTAAAGCCAGAACACTTCTAAAAAAGATTGATAAAATAAAATGAATTTAAAATGTATGACTATGGCTCTTCAGTTAATCTTCCAAATTAATAAGTGATTAGAGAGCCCTTACATGATGCTAGCTAAACTGAAAGATAAAAATTTAATAAAGCTTCTACAAGAAAATACTAACTAGATGTCACTAGTTCAATTGATTGTTTACCTGGAGTTTTTTTCAAATCTCCTTAACAATTTAAACAGCCTCCTAAAAAAGATGAAGCCTTTGCAAAGAGACTCTAAATCACAAGTGTAGAAAAAGATTTAAAAAATGGAAAAAAGATTGAAAAACCAAAATAGAATATTAAAAATCAATAATCTGGTGAATAAGCTGATTTTGATACTACATATAGTACAAAGAGAGTTCATGAAAAATCAAGAGGATAATAAGAACAGCAATTTGAGTTAAAAGATAGCTAAGGACCTATTAAAAATCCTTCTAATCAATACTCAATAAACAGATTCAAAACATAGGTAAGCTAAACATCTTTTTCTAGCAGCACTAGAATGAATTTTTATAAAACTAACTTTGTCTTAGGCTGA