TTHERM_00318530

Length: 6759 bp

cDNA Sequence

ATGGATGAATATTTAGAAAATACAAATCTTGAAGAGTTGGAATAAGAATGTTTCATGGAAGACTACTAACATGAAGATGTAGTTGAGCAGGAAAATCATTAAGTTGATGCAAATGATATATATGAAAATTAGCAAATGAATGATGAAAGTTAACTAAATTAAGATGTAAAAATAAGTTAGCAAAAAGAACAGGCTGTTGAAATGATTGAAGAGTAATAATAAAATAATCAAGATAAATTTAAACAATTTTAAGACTGTATGGCACATATAACAGAGTTAAATTTTAAAAGAAACTACTAAAATTTAACTGAATAAAGCTCATCTAATAATGTAGTAGCAGAAGAATTGGACATTAAAGAGTCTTTGAAATTGTAAATGGAGTATTATTTTTGCGATACAAATTTGACACATGATTCGTATTTAAGAGGAATAATTTCCAAAAGCCCAAAAAATTGTGTTGATATTAAGGTATTTCTAAAATTCAATAAAATATAATAGATTTTAAAGCAGATTCAAGATAAACAAATAGTCTCTACTTATGGCATCGAAAATCAATCATAAAAGAAAAATCATAAAAACTATAAAAATTAGAATGCTACCTTTTCAAAGAAAGATCTTATTCATTTAATAAGAGACTCCTTAAAGGAGAGTAAAATTTTAAAGGTAAAAATGGACAGTTTGAAGGTTAAAAGAAGGTTTCCTTTTAACTTAGAGCAAGCTCTAAAAAATTCTAAATAGCGTACACTATATATAGACTTTTTACCTCCTAAATGTTCTAAATAGACATTAGTTTCTATTTTTGGAAATTTTAGAATAATTAATATTAATTTGCCACTCTAAAAGAATTCTTAGTTATGTTAGGGATTTGCTTTTATTGAGTTTTTTTCGGAAGAAGAAGCTAATTAAGCTCTTATTACAAAGAATAGTTCTATTCCAAAAGAGCTCATTCTACTTACAGAGAAAAAAATAGGACAAGGTTCAATAAGAATCATCACATATAAGAAATGGTAAGAAGAAAAGTAATCATTTAAGGAGCTAAGCAAAAACCAGAATGAATAAAAAAATAAAAATATGAACTAAAGCAGAAAAGCAAGTGATGAATTTGTATCTATTGATGTTGAAATTAAACAAAACTGCTTAATTAAAATTATAAATATACCTTAGGGTACATTAAAAGCAGAAGTCGTTTTAGCAGTTAGACATCTTGGATATGAATTTTACTGTGACTATATAGACGAAAATAGTAATTAAATAAATAGCAATAAAATTAGTTTAAGCACTTAGCAGCAAAACACAGCATAGTGCAGTAATATCCAGATAGAAAATAATTTAATTTAATAAGATTAACATCCATAATTAAATGATTTATTAAAAGAAGGCCAAGCTATGATTAGATTCTAAAATAGTGATGAATAAAGATTAGCAATATAAAAGTTACTAAACCATAATAATAATAAATTATAGATAGAGATAAGAGGATAAATTTGTGATGTTATTAGTACAATACCTGAAGATGAAGAGAAAAATTATTGGAATTACATAAAATTTAAAAAAAATGAATTTAGAAAATTCTTCTTCATGAAAAAATATGAGTGCCTGCCTTATTTGCGATTATTAAAGATCGAATAACTATAAAACCAATTTTTAATCTATTAGGATCAGGTTGTTGAAATTGTATGTCTTTAGCTACCTTAAAATAAGATTTTTCTTTAACTTTTTGATTCTTGCAAAATAGATTTCCAATTTTTCGAAAATGAATACATTATGATTAGCAATTTAAGAGAAGGCTTCCTTTTGAATGTTGAGAAAAGCGCTTTATAAAATCTAAAATAAGAAGATAAATATCTACTTCATTGCTAATTGAAAATTTAGGCAAAATTTTCTTATTCAGAAGATTTATCTTATCAAGATAGAATCTAGTAAAAGACTTAAATGATTTTATATAAGAATATGAGTATTTCTTTCATACTATAATCTTAAGGAAGCGAAATACGACATATTTATGCAAATTAATTGATAAACAATTAAAAGAAATCTCGTTTACTTGGATCATGCCTAGTTGGATAATATTTAGATAGTAATTCAATTTGTTAAAATTGTGATTCATCATGCTATTCATGTGATTAATCACCTACAAAATGTACAGGATGTTAAATTGGTTATTATCTTTAAAACAATAATTGCTTTTAATGCTAACCCTCATGCTAAACATGTGATTAATAATTTATTTGCTCCTCATGTAAAGATGGATATTTCCTTGATCCCACTTATTTAATATGTATGTCCTGCAGTCATACTTGCAAAACATGCAGTGGAAATTCTTAAAAATGCTTATCTTGTAATGATGGATTCTACATGGATAATACTTAAGCTACTCCCACTTGTTTGGGATGTTAAAATGATTGTAAGACTTGCAATAGCTCCCCAACTAGCTGTACAAGTTGTTTTGATGGTTATTTTCTTAATGCAGCAAACAATTTATGTTAACCATGCGATTAGAAATGCCTTTTATGTTCTAATACTTCTACAAATTGTAATTCTTGTATAGATGGATATTATGTATTAAATAACACTTGCTAAATATGTGATAAACCTTGTAAAACATGTTAAAATTTATCAACAAAGTGTACAAGCTGTTATAATAATTATTCTCTTGACAGCACCTAATTTAAATGCAATTTATGCTCAAATTTATGCAAAACATGCGATGGCTTAACCGGACTATGCACTAGCTGTTTAGATGGCTACTCACTTATATCTGGTCAATGCTAATTATGCTAATTTCCATGCTCAACATGTGCATCTGGAAATGTAAATCTATGTTTATCTTGCTCTGGCAATTATTATTTAGACACAATTTTAAATATATGTAGTATTTGCAGCAATAATTGTGTAAGCTGTGTAAGTTAATCAAATTGTTCTAAATGTCAAAATGGATATATACTTGATGCTAATAATTAATGTATTGCATGCAGCTAAACTTGCAAAACTTGCAGCAACCAATTTAACCAATGCTTAAGCTGCTTTGATGGATATTATTTTGATAATTTGAACAAAGTATGCTCGCCTTGCATACCCGGATGCAAATAATGCAATAATTTGACTTCTTGTAATGTAGGATAATGTTTTGATCCTTATTTCTATGATACTACTTCGTAAACTTGCTTATAATGCAGTCCTTAATGTTTGAGTTGTACTGGAAATAATAATTGTACAACTTGTGAAGATGGTTATGTTCTAATCTCAGGATCATGTGTATAATGTGATTAGGATTGTCGAAAATTATAATTTTTTAGGAGCTATTGTTATTAAAAATATAGTTGCTCTTGTTCTCTTACAAAAGGAGTTTGTAATAGTTATAGTTATAATGATTGTGTATGTATGTAAGGATACTATAAAGTCTCATCAAATGCATGTAATAAATGCATATAGCATTGTTAAGATTGTACAGACGGATCTACCTGCACAAATTGCTTCCCCCCGTATGTAAAAACTAATTTAAATACTTGTGTTTTGAATAAGTGCGATTCAACTTAATATTTTGATGGAAGCTAATGTTAATTTTGTCCTCCTGGATGTTTAACATGTACTTCTAATTAAATATGCACTAGTTGTATTAAAAGCTATTATTTGTAAACATAAGCTAATGGGAATATATAATGCTTACCTTGCAAATATCCATGTGATACATGTGATAATGAAACAAGCTGTATTAGTTGTTTACCTAATTTTATTTTGTCTAATTCAAAATCATGCTAAAATTTATAAAATTGTAAATCGACTGACTCTAACTCAAAATGTTCTACTTGTATTGATAAGTTTTATCTAGACTCAACATGCTAGCCATGTGGAATACTTTGCTAAACTTGCAATAATTCGAATTCTTGTTTAACTTGTATTCCAGGATATTATTTAGATTCATAAAATTAATGCCAGCCTTGTAATTTCAATTGCTTAACCTGCTTAGATTAAAATGCTTGCACTTCATGCTTTGATTAAGGAATTTCTAGAGATGTTCCACCTTAATGTTTATGCAAAAGTGGCTATTTTTAATTAGGGAGTTAGAATAAATGTTCACAATGTGACCCAACATGTTAACAATGTTCAAATTTATCAACTAATTGCTCTGCTTGTGATGCAAGAGGATAATGTATATGTTAGCAAGGTTATTATGAAATATTTCAACCTTATAGATAATGCTTAGCATGTGATCCTACTTGTTTAGAATGTTATGGATCTGGTCCTTAAAGATGCTTAAGTTGCAAATCAGGCTTCTATTTAAATCCTCTCTATACTTCGTGCTAATGCTAATAAGGATAATTTTTAAATTCGAACGGAGTATGTTAAAGTTGTTAAGTAGGTTGCATTTTATGCTAAAATTAAAGTTAATGTTTATAATGTGGTTTAAACATGTAAATTTCATAAGATAAAACAACATGCTCTTGCTTAAAAGGATATTATCAAAATCAAGGTGTTTGCTAATAGTGTGATGTTGCTTTTTGTGAAGATTGTTCTGCAAATAAATCTCAGTGCTTAAAATGCTTTTCTGGAACACTTTAATCTTCTATTATATCAAAGTGTGAATGCTCTAGCAGTTCAAGCAATTAGTTTATTTCAAATTTAATGAGCTGCTCTTTATGTCATTTTTCTTGTGCTACATGTGATGGATTTGAAGCTCATAACTGTATTACTTGTCTTTCAAGCAGAAAATATAATTCTGTAACTTCAACTTGTGAATGCAAGGATGGTACTTACGAAGATGACGCTTCTTAAAATTGCTTTAAATGTCATTATTCATGTTTCAAATGCAATGGCCCTTTTGAATCTGATTGCATAGAGTGTCCATAAAGCTCTACTACATTTAGGTGCACTTGTGCTCCAGGATATTTTGATGTTACTTAATAGCAAATATGTTAAAAATGGTTTGCTTCAAATTGTTAAAGTTGTTAGGTTACAATGAATAGAGTTTTGAGCTCAATTAATACGTGCATTTGTAGTAGCGGATACTTTGATGATGGTTTTAATTTTTAATGCCAAAAATGTCATTATACTTGTAAAAAGTGTATTAATGGTACTAAATCTGGTTGTATAGAGTGTCCTGATAACTCATTTAGATATAGCTCATATAAAACTTTAACTGTTGATAATTCTTTTGAGTGCTTGTGCAACGAAAGATATTATGACGATGGTATTAATCCTGTATGTTAGAAATGCCACTACAGCTGTAAAAATTGTATTGGACCAAAAAATACTGATTGCATACAATGTGATCAAGTTATAGTATATTAAAGAATGTTTATTGCAAATATATCTTCACCAATTTCTTCAACTGGAATTTGCTAATGCGTTGATGGGTATTTTGATGATCTGACAAATATTTTGTGTTAGAAATGCCCCTATCAATGCAAAACTTGTGATATTCAAAAATGCTTGACCTGTGATATAACTAGAGATTTGGTTGGAATGACGTGCTAGTGTAAGAAAGGATACCTAGAAGTAGGAAACTAGGCATGTGATTCTTGTAGTCCTTTGTGTTCAGAATGCAGTTAAACAAGATACAAATGTACAGCTTGTAATACTGCAATTACTTTTAGATAATTAAATTAACAGAACTCTTGTCTTTGCTAAGAAGGTTATTTTGATGCCAGTAAATATGATTCAAAGACTAGAATACCTATATTAGAAATACCAAATTGCCTGAAATGCAAAAAAAACTGTAAGAGTTGTGGTCCTGAAAATCCTAACATATGTTTATCTTGTTATTCTAATTACAACTATGTGTTGAATCCAGAAGATTTATGCGTTTGCATGTTTGGATTTGAAGAAAACAATAGTATTTGTGAGGAAAAATTTTTAGTAAACAATTCATACATAGATGAGAGTAAATTAGATGCAATCAAAAGCATCATTTAAACTTTACTCAGGATTATCAAATTTGTTAGGGTTTAGACTTAATCTCATGTTAATTTATCTGAACTTTTGTAGTGTTAAAGTTCAGCTATATCTTTGATTGCCTTAATTATTTATGGAATAGCTTACATATCTTGCATAGTATTTTTATATTTAATTAATAAAAATGAGGAGAACAAGTTAAAAAAATTTTTTGAATATGACCTAAACCCGAACTCTGCAAACTTCTTCTTTTTACAATTTTCTATTGATATATTGATTTGTGCTTATTATGTAGTTTAATCGACAGATTTTAAATAGCAAACTATAATTATAATTCTTGGATATTTCGCACTTGGGTTTTTCGCCTTAATCTAAAAACCTTTTAAGCATTATTGGGAAAATTACCTTGAATTTATTTATTATGCAGGTCTCTCAACTGTAGTTATCCTTTTTTAGTAAGTAGGATAGCTAACATTGACATAATTGATGAATGATAATCAATAGAAGCAATTTAATACCTCCTCTTTTTATCTTGATTATTCTTTGATTGTGGCACTAATTATTAGTATAGCATGCATAACAATAAAGTTATCCAAAGGAATAATTAGAATTATGATTTTTATCAAAAAAATAAGAGAGTTTAATTAGAGTGATACTGCTCTATGGGAAGTAGAAATTTTAGAAACTGAAAAAATTATTACCTAGCACAGAAAATCACTCCTAATAACTGATTAATAGTAAATAAACAAAAATATTTTAAAAGAAATTATGAATTCAGATCTTAACAGAAAAGAAACAAATTCTACTCAACATATGTAAACGATCACTCTAACTCCTCGAACTCCTGGTAAAAGATATCACCTATGA