TTHERM_00320090

Length: 924 bp

cDNA Sequence

ATGGATACATAAAATTCGAATACTGATTCTACTACTACTATCCCAGTTGTTAATATTAATGAAAACAATTTTAAATATGAAGAGATTCCTTCTTTAGATCACCCTGAACCACTTAAGGTTAAGGTAAATCAAAAAAAAGAAATTCTCCTAAGCGGTGGTGCTGGAGCTATAAGCTTTTAAGCAGGATATATGCATGGATTGTCAGAGATAATTCCACTAGAAGTTTTAAAAGAGTACAGAGTAGGTGGTGTTTCGGCAGGAGCTTGTGTTGCTGGATTTTTCGTATTTTCTCTTTATAGCAAACATGACATGAAATACTGGTTCGAAAAATGCATCCGCAAGCTGCTTAATGTTGTAAGTAATTCTACTTTTGGATTTTGGCAGACTACTTCTTTGCTATCAGAATTAGCTGCCTCTTCTTACAGAATCGCTTTAGAGTGTGGTGTTCCTTTGGATGAAGCTTTCCACTGCTATATTTCATTAAGAAGTGGATTTATTGGATATAAAAAACACTTGGTCGATAAATTCATCAATGAGTAACAATTTGCAGAAGCAATTACTTGCTCATGTACAATCCCTTTTGTGACTTCATTTAGCTTCTCTAATGAATACTAGGGCAAAAAAGCAATAGACGGAGGAGTCACTATGGGTATACCTTTTAGAAATAAAGATTCAGAATGCATTTTCTTAAACGTTCTCCCCAAGCCATTCCGCTCTTACCCTATCGTAAGAGACTTCCCAAATCACTTAACTACTATAGATATAGCTGAGGACTATAATCTTGTATTCCCTACAGATTACTGGCTTTGGGATGAATAAAATGCTGATAAATAATTTGTATAAGGCTATTTAGCTGCAAAACATTAGCAAGATAAGTTGCTAAAAGCTTTTAATTTAGAATCTAAGCTCTAACCTGCTTAATGA