TTHERM_00327300

Length: 2301 bp

cDNA Sequence

ATGAAATTAAAGATTTTTAATTTAATTTATAGTTTATAAGTTGAACGAATACTTTTTTTTAGAATCTTTTTTTTAATAGATAAAAACTAGTTTATTTGTAAAATTAGATTTAGAAACTCAGCTTATAATAAATCAAAAACAAAAAGATATTTCAAAGTCAATCTTTTTATTAATAGGAGTAAATAAAATAGCTAAAATAATAAATAAATAATAGGTCACTTTAAAATTTAAATTTAGTTATTAATCAATATGAGGAGTTAAGTGATTGTTTAATAAAAATTCAAAGATAATAATGATAGCTAAAATTATAAACACATGTACATATCTTCCATTTTTGAAAATTTAGATCAAAATAATGAGAAATATATAGGCATTAAAAAAATTCTCAACTAAATTACTGAATATGAAGAGCAAGAAATATTACCTATTTTAATGGAAATCAATCCAAATGTTAATTATGATCGCATAAGTGAAGCTGAGTTTATTTAACTCTATTTGCGTCTCAATTTAATTCCAGAAAATTTTGAAAAAAACTAGATCCCATTTACATTTGCAGGAAATAAGCATATTGCTGTATGCTACAAAAGCTTTCCTGAAAGCAGAGATATTTTAGACAACTAAGATGAATTGGATATTATGAAATAATTAAGTGATTTAGGATATGGCTTAGATGCAGCTAAAAATTATAGACTTATGCTTATGAAAAATGCCAATCAGAGTTGGCGTAAAGTAAGTTCAGATCTTTGGCAATGGGTTTAACAATTAAAAGATGAATCATCTATTTAGTATTAAAATAGTTAACCTAAGCAAAATTAATAAAATGTAGTAGAGTTAAATAATATCTTAGAGTAAATTTAAAAAACTGATTAAGGCATAAACTTAAACATAAAGTAATTTTACCACCACAGACTATACGACTTTAATAATAAATAGAGATAATAATGTCTAAAGATATTTAAATGGGCTAACCTTCCTCTTGCTAGTTAATCTGATCAAGGAACTTAAGCATTTTTCCAACAAATTAAGTAATTTGACGAAACCAACTAGCACATAAGAGCTGCAACAATTGCTTCTTTTCATTTTGAATTTGATAGAGCTCTTGATAGCTTAAATAGTGCTTTAGAAGATGATCCTTAATTGAGAATGATGAAGAGTGTATTATTAATTTTAAAAAATATATAAATTAGCATTTAAGGAGATTAATATGTGAAGAATAGACTTGAAAGTATTTATCCTTCTAACTCTAGAGATTATACAGAGTAAGATATGTCATAAGAAGATATTAAGAATGCAAAAAATACTAATTTTAAGAATTAAGAGATTTAATCTGAGTTTAAAAATATAATTAACAATGATCTGAGATATACAATTGTATAAAACGAATTAAACTTTATTTCAAATCTTCTCAAAGACATCAAATTTAATAATCCCTACTTGACTGCTCTGGCTAGATTCTTAAATAACGATGATCCTTAGGAAAGAGTAAAGGAAATCATTTAATAGGATGGCATCGAAATATTTGACAAGATTGCATTTGCTTTAAGATTTTTAGACGATGATAATATAATTACTTATTTTACAAATTTAGTTTAAAAAGCAGAATAGGAAGGTATTCTTGAATGCTTAATATTAGTTGGTAAAGATTAAAAAGCCATAGATATCATCTAAGCTTTCATAGATAATACAAGAGATATTTAGACAGCCGGTCTACTCTCTGCACATTTGAATTTACATAAATATGAGCCTTCAGAAACTCTCTAAAATTGGTTTAAAAATTATAAAGCCCTTTTAAATAACATGAATTTGTTTGAAAAGCGTATTACTCTTGATAAAGAATTTAAAAATTTAAAATAACTCCTATGCAAGACTGATTCAGAATAAAATAAATCTTCCTTTAAGGGATCAAAGATATTTTTAGAGTGTAAGCAATGCAATAACTGTCTAGACAATAAAACATAATTAGATAATATTATAAGAAGAAGAAGCATAAGAGGTTATGCTGCCTTGTTACAAGTTTTAAAGCCTATGATAGGTGTTTGTCCTTCTTGCTGTGTTATGCTGCCTGTTTGCTGCGTTTGTTTATTGTCTTGTGAACTTGTAAACCCTTACATATAATTTAACAGAAACAGATAACAATAAAATTAAATGGGAGGTTAGATTGAAAATCTTAACTTAGAAGAAGGAATTGTGTGGTGTTAGTCATGCAATCACGGAGGCCATTATAAACACATAATTGAATGGTTTTAAGATTTTGATGTTTGTCCAGTGAGCGATTGCAGCTGCAAATGTTCAGTGATTTGA