TTHERM_00334410

Length: 9252 bp

cDNA Sequence

ATGAAGCAACAAGGTAAGACAATAAAAGAACCTATTAAGCAGCTCCCATAAGAGTCAGCTGATGCTAAAAAGAAATAATAATAAAGCAACAGTAACAATGTTTAGTAGGAAAAGATTGCAGTCAAAGAATAAAATCAATTATAGGGATAGAGTAGTAAATAAAATGCAAAAGATTAAAAAATATAGCTAGCTCCTTTAAACCCATAAGTTTAAAATAAGAAATTAGAGAGCTCAATGCTCAATGAATCAAAGTTATAAATGTCAAGATCAATGCAAAATTTAAGCAATAGGACACTTAATAATAAAACTATTAGATATCTTTCAAATTTAGATCCAATTGAAATTCTTCCATCAGAAATCATTTTTAAAGATATTCAAGTTAATTAGACTTATGAAATATAAGTTTTTGTTCGTAATCTTACAAAAACTACAAGAAGGATTAGAGTATTTTAGCCTTAATCAACTAAATTTAGAATAGACTATGGCGTTATTGGTGGAATAGCTGCAGGTTTAGCAATTAAGCTTACAGTTTCATTTGAAACTTCGGTTTTAGAAGATGTGCATGATTATATGAAAATTGTTTCAGATAATGGTTATGAAAAAGATATTCCACTTCACGCATATGTTTCTAGTGGCTAAGTTATTTTTGAACCATTTATAAATTTAGTGTACTACATAAAGATCAAAAGTTTTATCAAGTTGGGAAAAGAAAAAAGAGAGGAGATTCTCTTTAAAAATGAAGGAAATGCTCCTGCTAAAATTGATTTAAAAACTTCTGATGTGAATGAAATTTAATTTGAAACACCCTCTTTTACTATAAAGCCAGGGTAAGAATATAGTGCTGCATTTAAATACACTCCAAAGGACGCAGGTATTTACAGAGGAGTTATTGAGATAGTTACAGATGCACAATGTCTGCAAAAACATATAGATATAAATGCAACTTCAGTAGATTTTACTAGATTTATTATTGATGAAAATGGTAGTTAAGTATCGTAATTTGATTTTGGAACTTTTTATTATGGTCAAAAAAAAGCGATTGTCGGATATTTAGTCAACAACACTCCTAAAAAGTATAGATTTAAAACTAGATTTAGATTTGGGTTACTTTACTCGTTAGATGATATGACTAATGTTTAGCCACCCAATATAGTTGGTAGAGAGTAAACTGAAAAAATTATGTATTGTGAGCCTTCTGAAGGAATAATAGACAGTTATTCTTAGGTTGAATTAATGTTTAAATGCTAGTCATAAGTTGATTATTAAAATTTGTTATGGGCTTAAAAATATTGTCTTGAAAAGGATGAACTAACTCCTAAAATTTAAGACTAATTTTATTCTGCTATTTTTGAATTTGATGGTGAATAATAAGAACCTTTAATACTCCATTTATCTGGTAGAGGTATTTGCCCGATGGTGAAATTCTCAAAAACTTTATTATAATTTGGAGAATGTTTAGTTAACGATTACAGAGATATTATTCTAGTCCTTGAAAATAGAAACAAAGATTTACCAATAGATATTAATATTTAAAATACACCTGGATTTCAGTTTGAACCAAAAAAGTTTACAATTTAAGAAGGAGGATAAGTTCCGATAACTGTAAGATTTTAGCCAAAGAGTGTTGGAAAGTTTAACCAAAATATGATCATTAAACTTGTTGAAAATGCCTATGATGTCAAAGTTAAACTTTATGGAGATTCGACCGAAATAGGTCTAAGGCATAACTAATAAAGAGGACCAGAAAGTTTGCCTGAAGATTTCTTTATGGAAAGCAAAATTATAGATGAAGAATCAATACAATTTAACTCAATTAAAAAGAAATTTGATTAATCAAGCATTTCATCTTATCCTAAATACCTTGAATCTATTCTTGATACAACTTAAATAGCTAAAATAGAAGAATTCAAAAAGAGTTTTGATAATAGACAAAAGTATAACAATGAGTTAAAAGAGCAAAGACAGCAAAGATTGAAAAAAGAAAAAGACTAAAAAGTTTAAGAAAAGTTTTAATAAATTAAAGAAAAACTTAGATTATTGGGATATGACGATGGTGATAGTAAGGAAAACGATGAAGATGATGAAAACAAAAAACCAATAGGCAATAATCCATTTAAAGATGCACCTATTGATTATGAGTATGAAGTTGGTATGGTAGACTCTAAAGTAGAACCTCCTTCATTAAGTTTACCTGAAGCAAAAGAATCATTGTTTGTTACTAAACCTATTGATGACTATGAACCATTTAAGTAAGATGACATCAAAAATTTTGAACCAGACCCTAATATACCTGTTAAAAAGAAATTTTCTAGTGAACCTAAAAACCATTCTGAAATAAGAGATGTCAACACAGTTTTAGATGGGTTTTAATTACAAAAGGTTTTTGCTGGGCCTATTTATATTGAATTTGGAAACGTTTATGTTAATTCAGAGATGGTCAAAACCTTTAGAGTTAGGAACGACTTGAGGGCTGCTATATCTGTTAGATTATTTACTGATCGCTAGGAATTGAAAAAAACTTATTAAAAAGCATAAATCATTCCAAGTGGACAAACAGCTGGTTTTGAAATCGTTTTAAATTCTCGAAACCTAGGCCCATTACGTAGCAACATTAAGTATTTCATAAACGAAAAGCATTCGTTTGAATTCTAAATTGTGGCAAACATAGAGCTTGTTAAGATTGAAATATCTAAACCTTTGCTTAAAATGAGTTTTGGAGAAGATAATATAGAAATGAGCACTAAAGAAACTATTAAATTAGTTAATAATGGAAATGCTCCAGGTAAGTTCAAGTGGCATACAAATAACTCTAAGATATTCACTATTACTCCAGAAGAATCTATTGTTTATCCTTAGAAGCCAGTTGAATGTACTATTGTTTATAAGCCATCTTCTGTTCAACAAATAGCAAATACTTCCTCAACTGGTGCAAGCTTTTTGCAGTCTACGAATCAAACATCTGTCTAGGCAATAACAAGAACCGAAGAAGAAAAGTTAATTCTGAAAGTAACAGATGGTATTGAGTAACAGCTTAAATGCATAGGATCGTATACTGAAGCAAAATGTTCTCTCAAATAATAGTCTTTAGATCTAAAAGAAATATGTGTGGCTTAACTGATAGAAAGAACCTTTGAAATAAAAAATAACAACAGATAACCAGCTGTATTTTGTATAGAGGAATCAAAATTACCTGAAGGAGTTATTATTTCTTAAATGAAAGGTAAAATTGGGAGTGATGACACAAAGGTTTTGAATTTAAAGTTTAGCTCTAAGAAAGAGTGCAATATTAAGGGTGATATTGTAATTTTAATTAGAGGAGGAAAGACTCTGAAGTTGCCTTTTTCTGTTTCAACTATTATCCCAGATATTCAAATCAACTAGGATAAATTTGATTTTGGAAACATAACTACTTTAGATTTGAGATACGATGAGGAAAAAGATGGTATGGATGAAGAAAAAGATGGACTTGATTGCCTCGATGTCGCATGTTTAGAATAAGCAGATGAGAGTATTTTACACTCTATAGCTGATCATGAAGAAGAACAATAATAAATTGATTCAAAATCAAAATAAAATGCTAACTAACATATTAACAATAACAATAATGCTGATGATGAATTTGATTAAGAGAATTTAGATGTGTCAGAGTAATCTGAGGACGAAGAAGAAGAAACCAAGCTGTGCAAATATTATTCTTTAACAATATAACCAGGATAAACCCTTCATTTCCAACTAAAATTCTCACCTAAAAGTTTCAAGTAAATAAAAAAAATATATTTTGACTAAAAGAAGTTTATTATTAACAAATAATTAAAGCTAAGAGGATATGGCCTGATTGATGGCTTAAAAAGATTTATCTTTTGCCGTGGTTTGAAGCCTAAGTTTTTAATTGATCCCTAAGTCTTAGATTTCGGTAAAAAGATTATCACAGCTCCTGATAAACAATCAATAGGAAAGTAGTCTATTCTTTCATTCTCAAACCCTGACAAAAATTCTGTTTCTTGGTATGTTGATACAAACGTATTAGGTAATGACCGTATATTTGATATTCGTCCTGATCAAGGTGAAGTAGGACCTGGAGAATCGAAGAATATCTCAGTATTTTTTAATCCGTTTGAACCAGGTGTTTATGAAAAATAGATCCCATTGTTTGTTAAAGACCCTGATATGAAGATTAACAGTTCTTACATCGATATTACATTGAAAGGAGAAGGTGCCTTCCCTAAGTTGCTTTTTGACAGAAAAGAAATTATTTTACCAGTAGTTCCTTTAGGTGTTGAAGCAAAGTGCGTTTTTAGAATTATCAATAGTGGATATGAAAATCTTAACTTGAAATATAAAATAGTGGATGATATTTCTAAACTTAATATTGATCTAGCCTTTCCTGAAGGTAAGAATCTTGGTATTACTAAAAATAAAATTAAAGTAGAAGCCACATTTTCCAGTAAAAAACCAATATCATTTACCACTCGAATTGAGTTTTATGATGATGCAGAAAGAAGCTATGATATATAAATTTCAGGCACTACAGATAATTCTCTTTTTACAAACTACTCCTATTTCTAGAGATGTGCTGGAGAGTTTAAAATTGATTTAGAGCATGACAGATCTCCATTAAAGCTTGAAGTAGATGAAGATGATTTGGATTCAATAGATGGACTCTCAGATGGTAGGGTTGGCAAAGCTGCAGCTAAAAAAAAGGTAACAGGAGGAGCTTAAAGCGTCGTTTCAGCAAAGACCCTCTCATCTTATGGCTCTTCTAAATCGACTAAATCATTGCTAGGATATTCTCCTATTCCAACATAGTATTTAGAATAAAATGTAGAATTTTTATGCAGATGGCTTAACTTTTATGTCTTAACATAAACCATTTAAAATTTTCCTAATTCTATAATTGAAAGTAATGGGGCTTAAGTGTTTGATATTCTTACTTATCTATCTGGCAAGACGGCATTTAATTTCAAGGCTAACATAGACTTTTCAGCTAAGAGACTTGAAAAATTATAACGATTATCTCTTTTATTTAAAGACACTCCCAGAAAAAAAGTAATAAAACTTAACACCTTCTGCGCTAAAAATGCCTGCTTTAAGGTTTTAATACTAGTCAATAGAGGCTTGGACAAAATTAATCCGAAAACATTTAAATCTGTTCCTGGTCTTCCACCAGAGAAAGCATAAATACCAGAATATATAGAAGGTAGTAATTTCATAAGTAGTTCTGAGGCTCTCTTGCTGAATTGGTTTGAAATCCATAATGAAATCATTCATCCTATACAAAAGAGAAGAATACGTAATTTTGATGAGGATTTTTAAGATGCAAATCTGTATGCTTCTGTAATTCAATCATACGTTGGAAAATCTTGCTACAAATATTTTAATACAATGAAATCGAGTTGTTCAAGTGATATAGAAATCAATTACAATGCCGAAAAGCTTATTTAAGGATTAACAGAAATAGGTATGCAAACACATCTTAATGTTAAAGACATAGTAAAACCATCGATGAGAGAAACTCTATTGTTTTGTATTTAGCTATTTTTCTCTCTTCCCCACTACATTCCCAAAGGATAACCAATAATCTTTTAATGTGTGCTTGGTGAAGAAGTAGTAAAAAATATTGAGTTGCAAAATCCAACAAACAAGCCAATAAGTTATTGGGTCTAATTAGAACCTCAAGGAGGTGATTTTTCTCTTGAAAGCGATGATAATTTTGTTATTGAACCTAAGTAAACATTTAAATTTAAAGTTAAATTTACCAGTAGAATATCTGAATCTGTGACAGGCCGTATTAGATTTACTAACAAAAAAGAAAGTAACGTAAGTGCTGCTGCACTTGTTTTTGAATTAAAATCTTAAGTGATTGGAAGAATATCTGAAATAAATTGGACTGTTAATGCATAGCTTTATGAAACAGTTGAAAAGTAGATTTAAGTTACTAATAAATTCCCAAGTGAGTCAGGAGAATTTATGATTATCATCACACAAGAAAGATTCAAAAATGCTGAAGAAATGAAAAAAAAGCGTACTAATAAAAAATCTTTGACTGCTCAAGGTGATTAGTAATCACTATCAAATATTAATGATAACACAGCTCTTGCTCCTTCTAAAAAGCAAGAAAACGAAATATTTCCCTCTTTCTTTTGCTAAAAAGCTTCTATTCGCTTAAAAAAGGGTTAGACAACAACTATAACAATAATTTTTATTCCTTTAGTCATGGAAACACAAAAATGTTTTATTATTTTTAAAGACCCTAATGTAGGTGAATTTTAGCATGAAATGATTGGAACAGTTGAAATGCCATCGCTTTTACCAGATATTATTCGCTTTCCCTTAACAGGATATCCAACAATTTTTGTAGACGAGAATTCATAATAAGAAGTTGAAATACCTTTTGCAAATGACCCTATGTTAAAAGCTAGAAAGTAAGTAGAACAATTAATAGTTGAGAAGAATAGAGATAAATATATGAGGGGAGATAAAACTTAGGTTATAAGACCTGAGAAATTGAATTTCCCTGGTGGAAATCCTGATAGTGTATAATATGAAATAGAAATGAATCCTCCAAATTCATTTATCTCAATTAAAAGCTAATTTGTTGTCATAAATCCATTCAGATTCACCAAGAGTAAATAGGAAAAATAAGAAAGAAATACTGGAGAGTCTAAGAAGGCGAACTAAAATCACACTGAAGAATCAGGAAATGTTTTGTAAGCTAACTAAACAGGATAAGCGTTTGCAAGCTAAGGAGTTAATAAATATCCCTTTTAATTCCTTTTCAAATAGCCTGTAAAAGACTATAAGTTCAATTTGACTTTTAAGAATGCTTAAAAAACTGATATTCGTAGATATAGATGCGAAATTACTGTTTTCCCAAAACCCATAAAGGCAACATTAGAGTTTAGAGTTCCTGCAAGGCACAGCACAACATAAGAGATTCCAATTATAAATAATACAGAGAGAGATTGGAATATAAAAGTAAATTTAATTTAAGATGCCAAAAATGCACTACTATTTACTGCTCCCTCTCATATTTTGAAAGACTTTTTCGTTAAGAAGAAAAGTACAGGTGTTTATCCTATAACCTTTTCTCCTAATTGGCTCGTTTAAGCAGAATCTAAGCTAAGCTTATTCAACCCTCTCACTAATGATTAATTTGAATATGACCTTAAAGGATTTGGTGAAGAACCTGTAGCAGAAGACCACATAGTTATCAGTTGTAAAGCTAAGTAGCCAACAACTAAAGAAATCGAAATTCGTAATCCGTATACAGATAAGGAAATAGTTTATAGAGTAGAAACAGATCTTATAAATGCATCAGGACCTTCTTCTCTGGCTATAAAACCTGGAAAAAGGGCAAAATATGTCCTTACTTTGAATCCCATATTAAGTGGATAATACACTGGATCAATAACATTTTATGAAAATGACGAAAAATATTTATGGTACACTGTACTCTTGAATACAGAAAGCCCAAAACCAGATAAATGTATTGAGATGAGCACATAAGTGAGGTAGGCTGTCACATTTAGTATTGAAATAAAAAATCCATTAAGCTAAGATGCAACTTTTGAAGTTATGATTAATGGTGAAGGATTAATAGGTGATACATTATTTAACTTACCTGCAAAGTCAGAGGGAAATTATGAGCTTATTTATTCTCCTCTCGTAGTTGGGCGATAAAGAGGTTCAATAGCTTTCATAAATGAGTTGCTTGGAGAAATTTGGTATGAGTTAAGTTTAACATGTGAAGACTAGCCACCAGTTAGAATGAATGTGTTAAGATGCGAACTTGGAAAAGTAGAAGCGCATTAAATATTTTTAGAAAATCCCTCTGAAAAGGAAGTTAAAGCAACAACAAAGGTTTCAAATCCAACTAACTTTGATGTAATACCAGACAACATAATTTTAAAACCTCTTTCGAAGACACCTATACAAATTAGATATATGCCTTCAAATCTTGAAGTTACAGAATAGGGAGAAGTTACAATTTCAACACAAGAAATTGGAAAATGGAAATTTTTAACTTTTGGAATAGGTATACCTCCAACTAAATTTGAGCCTAGATTGATTTCAGTAGGCCTTAATAAAGATTTTTCTACAACAATTCACTTCAAAAATCCATTTAAAGAGAATATAAATGGTGAAAATAAAGAAGTCTTCAAATTACTTACAAAAACTAAGAAAAATGAAGGAGAAAAATCAGTTATGCAGGTTCCTGGAATGAATGTCATTTAAATTCCATTTTCGTTTGTCCCTAGAGAAATAAATTGCTATTATTGTGAAATTGTAGTTTAAATGAATGAAAAAATTGAATGGAGATATCCTATTAAAGGTGTTACAGAGAGCGTAGTAAACTAAGTTATTTACCACCTAAAGACTTAATGTAGATCAACAGTTGAAGAAGAAATGAAAATTTAACTACCTGGACTATAATAGCTTAATCTTTTATTACTTACTTCAACAATTTCTAATACTACTTTTAATATAAAAAAGATAATGTCCTTTATTACAAATGAAGATAAGTTTGAGTTTGAACTTGATGGCATTTCTGACGAATTCAACACTTTGATTAGATAGAGTTTACAAATAAAGACTGTTAAAAATTACTTGACATCTTCAAATGATCATCTTGAGTTCCAAGCTAAATTTTCACCCTTAAAGCCTTTCAAATAAACAATTGATTTTAATATATTAAGACAAGCTGGTGGGCGCTGGAAGTTTAAAATAACTCTTGAAGCTACTGAACCAAAAGAAGATGATATTATAATAATTAGTTCGCCACTTCATAAAACAACAAGTGTTACTTTTAAACTAACAAATAAGTCCAAGAGTTTTACTCCTTTTACTGCTTCATTTACTCCAGATAGTGATGCTGAATTTACTGTTATGCCCAGGTCTGGGAATTTAGAATCTTACGGTAGAGAAGGAACTACATTTATAGTATCTTTTACTCCTATTGAATATGGAAAGACAAGACAGGGTAAGCTCATAATACAGACAGATGAAATGATGTGGAGTTATTTAGTTAAGGGAACTCTACCAAAATATAATCCTCCATAAATAGAATAAAGCATGATAGATAATAAACTTGATATAGATTTAATCTCTAAATCAGTGCATAATAATCATTCTAAAAACTTTATGGCTGAAAATGTCATAAAAATGAAAAATTCTTAAGTAGAGTCAAATATGAAATAACTTTAGAAACACAATAGTTCACTTTCTCTTTAGCTCAGAAGCAAAAAATTCTGA