TTHERM_00334510

Length: 1689 bp

cDNA Sequence

ATGCACGGAAAGAGAAAGAAAGATGTGAGACCTCTAACAGAAGAAGAGAGAAAGAAAACAGAAGAACAAGGAGAAAAAATTATTGGCTTGATTAACGAATTCTTAAGTATCCGCCATGGAAAGAAACCTGTCAATAACCCAGGAGAATATTGTGATTTAGTTGCTACAATGTGTCCTGATCTTCCTACAATTTATAACTACAAGCGTGAAGTTTTAATCAAATAATTTAAAGAAACTAAAAACCCAAAGGATTAATATAAAGCATTGATGAATGAACTATAACTTGTAACAGGATTACTCAAAAAATCACCTAAAAGTTATTCGTTATGGTCATACAGATAATGGCTCGTCCTCTAATGCAGAGAACTTGAAAGACTCTATAATAAGCTAAAAGCAGCAAAAGAAGCTTAATTAAAAAAACTTTTAGAAGAGCAATAGCAAGATGGATAACAAATTTAAAAAGAAGATTTATTAAAGTAATAAGAAGCTGAGGAACCTATTCCCCAAGTCGTTGAACTAGAATTAAAGCTTTGCAATAAAATGTTAGACATGGATGAAAGAAATTTCCATTGCTGGAATTACAGAAATTGGCTTATAAACGACGTTGAAAAGAATAGTTTGAATTACATAGAACGTGAAATCACTTATACTTAATAGAAATACGAAAATAACTTTTCTAACTTTTCAGCACTCCACTTCCGCTCTAAAAATTTAATCAAAAAGTATGATTAAGATCTTGAGTCTCTTTACAAATCTGTTTCTACTTCTCCTGAAGAAGAACAAAAAAATTTAAAATCTAGGATACGTGAGTTGACCTAATTTAAAATACCTCTATAAAACATCAAAGACGAACTTGAGCTCATCAAAAATGCTATTTTTATTTAACCTAATGAATAAGGTGTTTGGCTTTATCATAAATGGTTAGTAAGTCTGCTAGTACCTTTCCGCTTTATTTCTGTTAATCCAGTGAATAAAGAAAACACTACACTTCAAATTACTTGCTCTTCAAAGATCATCAGTAATAATTTAGCATCAACTATATAGCTTTATGATCAAACTGGAAGTCCTGTCAACAATTTCACAATTGAGGAAGTAAGAAATTAAGTTGGTCAAGTCTTTAATATCAAAGCTGATAAATAAATATAGAAAGTAGTAGTTTCTTAGCCTTAAAATATATAAATGTAAGTTATAGACTACTAAATTTCAAAAAGAAACTTAATTTCTTCTGAATTTGTATTGCAAGAATGCAAATAAAAATATAAATTACAAAAATTAGATGACCAGGATTATCAATTTAGCGAAGTAGCCTATCAAATTCTTTTAGAAGAATAATAATTTGTTGATGAAGTTATAGAAAATGAAAAATAAAGCAAATTTGCACATTTCCATAAGCTTTACTTAATTCAAGTTAAATAAGGACTTGATTTGATTTTTAAAACTGACCAACATCATCTAAGCTTAGAATCTACTTAAAACATAATAAAAGTCATTGAGAGTTTGAACTCTATTGCTAAAAAGCAAACAAACTACCTAAAAAATTTAGAGAGTCAATATTAATCTCTTTTATCACTTTAACAAACTCTTGAAAAGCAGAGCAGTGGCTAATAAATAGAAAAAATATCTCTTCCATCTTCCCCTACTTACGAAATCGATCTTTTCCTTCCTTATCACTCTCTATTATAATAATGA