TTHERM_00338450

Length: 294 bp

cDNA Sequence

ATGGGTGGCTGCAGTGGTAAAAATAACCCTAAAATGAAGATTTACATAGAGCATTCTACAGAATAGAATATTATAGAGGCTTATAATTTAACAAATTTGTAGATTAACTAGTAATTAAAGATTTAAGTTTCTGAGTAAATCAAATCAAATCAAAGCAATATATTTACAGTATATGTTATCAACCCTGGTCATAACCGCGAGTAAGTTTGGAGCATATAATAAGGTGATGAGTTAATTAGTTAATATAATATAAAGGATTTGATTGAGAAAATAAAAGATTTATCATAAAAATGA