TTHERM_00338550

Length: 735 bp

cDNA Sequence

TTTTTAGATATGTAGGAAGCATAACAAGACTTGCCTTAATGGTTAAAGGCATTAAAAAGATCAATTATCAATAATAGATAGCTTTAGTTTTCTAATATGTCTCAAATCGCTTATGTATTTAATGGAGAAGCCGGCATAGATAATATTACTTTTGATTCTTATGAGAAAGTAATTAGTGATAATCCATTACAAGAATATTCCCTCATTTACACAATTGATTCTAGAAAAAATACTTTTAATGAAATGAAAAACAATAAAGTTGTTGAACTTTGTTGGTATTTCCCATTGACTAAAGAATAATATAAAATAAAATGCCATTTCTCTTTTATTGCTTTATAATAAACATAAATAAATGATATATAAATAACAGAAGAAATCTTAATTGAATAATTACCCTAAAATTAAAGAGAATTATTAGAAAATGCATGGAATAAAGTTGATAAAGAGGCAAAAAAATTGTATCAATCACCTCATCCAGATACCTGCAAACCTAACTAAGAACCTTTAGATGATTTAGAGCGTTTTAATACTCCCGAAAAAAATAAAATATCTAATAATTTTGCTCTATTAGTGCTTACTCCTTTCAGAATGGAACATACTTCATTTGCTATGCCTTAAGTTGTTGCTGATGGTCGTAAAGAATTCGAATCTATATTTAAACCCTACAAAAAACACTCAAAATATTTATATGTAATTGAGAATAATCAATGGAAAGTTCATACTCTTAATCCTTGA