TTHERM_00346760

Length: 1074 bp

cDNA Sequence

ATGCATAAGCTTACAAAGCTATTAGGTTAATACTAAAAATAAGTTTTAAATAAATAAATTTTATAAAACTTTAAGCCATTTAGCATACAGCTTTAAGTTTAAAGTTTAAGATAAAGTTATCATACATTTAAGTATAATTATTCTAAAGCTTTTCCTAAGTAATTAACTTATGTTACAGCATTTAAATTTTCTAATGCATAAATTAGCTTTGAAGAATTAAATAAAATAAGTGTGTAACTTCTATAGGAGCTAAAAAGCAATCAAGATGTAATAGAATAAATTGTAGTACTCTCTTAATAGTATTTAGAAATAGAAAGAGTAGAAGAAGCTATAAACATATACATTGAAGCATTAAAAGTATACCCTAATTCAGCTAGATTAAATTGTAAGTTAGGAACATTATTTGTCTAACTTGAGGAACTAGAAGAAGGAGTAAAATACTTAGAAAAAGGAATTGAAATAGACTACACTGAAATGGGTAAAGAAGGATTAGTTGGTTTAGCAAGTTTATATAAGATGCTAAATTAAAATGATAAAGCACTAGAAACATACATGAAATCAATAGAGCTAAATTATCTACCTTCTTACTGTCATTAATTTATAGCTTTGTTATATGCAGAATAACAAAAATTTGATATAGCTTAAGATCATTTTTAAAAAAGCTTAGAAATGAACCCAAACGATTTTGCAAGTCAATGGGCTTATGGTGAAGCAATTTTTCATTATGATCAATAAAAAGGAATCAAGATTATGAGAGAAGCAGCTGAAAATATAGCTACTAAAAAGTGTGAAAACTAGTTTATGTAAGAAGATGAAGTATAGGATATGATTTCTAGCATGAATTTCAGAGTAGGGTAAATTTTGTAACATATTTCAAAAAATAGTGAAGAAGCAAAAAAATTTTACAGAGTTTGCTTAAAAAATAATCCAAACCATGTTGAAGCTCATGTTTAGTATGCTTCATGTTTAAAAAAAGGAGAATAACCTAATATTGAGTTAGCTGAATACCATCTTCAAAAAGCTAAAGAAATTGACCCATCAAAATTCTAAAAAAAGTTAACTGAGTGGTGGTGA