TTHERM_00346810

Length: 1023 bp

cDNA Sequence

ATGTCATAAGTAAAATAGGAAGAAAAGAGTTTAGTTGAGGAGCTTTAGCTTGATTCAATAATTTAAAGGGATTTCCCAAAAATAGATTTCGCATTTGGATATGGTTCAGGAGTTTTTAGATAAATAGGTTATGATTATAGTAAAGATTCACCTATGATCGATTTAATATTTGGAGTATAAGATGCAGATGAATGGCATAGAATGAACTTAATAAAAAACCCTTCACACTATAGTGGTTTGGGTTATTACTTAGGTTCATCATATTTACATTTTTTATAATAATACATCACTCCAGTTCATTTCAATCCAAGCATTTAAGTTGATTCATTTGATTAAAAAAGGAAACTTAATATTAAATATGGAGTTGTTGATGTTAAATAGCTTAGCAAAGATTTGTTAAAATGGAATATTCTCACTTGCAGCGGGAGACTTCACAAACCTGTTAAAATTATTTAGCTTGATTAAGTCCAAAATCCTACTTTAAATTCTGATTTAAGGGTCAATTTAATTCAAGCAACAGCAATCAGCTTGCTCTTAAACTTTAAACCCTATATTGAAATGAAAGAGTTTTTAATGACTATTGCTTCTCTTTCTTATATTGGAGATGTTAGATTTTTATTTGGAGCAGAGAATAAAAACAAAATTTAAAATTTGGTAGAAGGAAACTATGATAGATTTACTCATTTATATAAAGATGTTATAGAATAAAACAATCCAATTAATAGCTTAGCCCAAGTAGTTGGAAATAGAGCTGAGCATATCAAGCTCGAAACTAACTCTGAGACTGTTTATTAACTTGTAAATTGTCTCCCTGATGGTTTAGGTTTATTTGCAAGAACTAATGAAATAAATGTTAAAATTATTAATTTGGAAGACGTTTAAAGATAGATTATTGAAAGAATCAGAAAAATTAATATGGGATCCTCTTAAAAACTAATTTTATACAATACATTAGCAACTTCTCCTACTAAAAATATTTATTACGTTTTCAAGAAATTACAAAAAGGAATATTAAAAAGATGA