TTHERM_00347920

Length: 672 bp

cDNA Sequence

ATGGACACAGAGTTTTAAAAAAAGCTGATTCCAAAAGTGTAAAGTAGAGAAGATATATTAAATGAATCTTATAAAAATTCTATACATGCTTTTCTATACGAAAATAAAGTTTATGATTGCTTACCAAAAAACTCATAAGTAGTAGTTATAGATAAAAATTTTTCTTGTGCCGAAGCCATGAATTTAGTTATAAAAAATGACTTTGAAGAAGCTATTATTTGGAATTAGGATACATCGTAGTTTGATGGAATTATTACTTATTCTGATATTGTCAATATTATTTTGAAAAGCTATAAAAACGTCGCTCTAGGCTAAATTCCTTTAAGCGATAGCTAAAGATAAACACAAGGATTTGATAAGCTTCAAGAGGAATTCAAAAAGTTTAATGAAGATGATTAAATGGCCGATGATAATGATGTGGGAGTTTATAGTAAGAATGAAAATGAAATGGAGGACGAAGACATTAAATTAAATAATAACAAAACATCTATTCCTATGAATCAAAGCATAAAGCTTAAAGGGTAAGAGTAAGAGTTTCATGCAGAAAACTACCCCTTTAATGAAGATTAGAAACAAATTTTTCTTTCAGATTTACAAAAACTTTCTGTAAGAGGGTGGTTTAGAATACTTAATCAAGATATTAGGAAAGTTAGTTAGTTGTAGGTATCCTGA