TTHERM_00348250

Length: 2523 bp

cDNA Sequence

ATGAATGTTTAAAACTCTATGGATTAATTTTCAGAAAATTAAAGTTCTATTTCTGATATTTCTGCTAAGTAGCAATATAACTTTTAAAAATTGAAGTAGCATTCAGATTTTTTAGCTAATTTTGTTAGGGATAATAATATTTCATTAAATGATAATCCTTCAGTAGAATCAAAAATTATGGAAACACCTTAGCGATCAGATATTGTTGGAATCAAATAAGGATAGATTAAATCCTATATTACATCACCTCCTTCTTAAAGAACTTACTAAGAAGGAAATAGAAATATATAAAATTTAATCAAGGAAGAAACAGATTAACGTTATCATGATATCATTAATTAAAAGAGTTCAAATAAGATAAAAAAATATGAGCAATAAGATGATAGTAGTAGAAATTCTTATTAATTTTAGAAATAAAGGGAATAGAATGATTTATAAAACTCAAGTGATACCAAACTCAAAGAGAATATTCAACAGAAAGACTATCAAGAGGATAATTACGAAAATGAAGATGATTATCATTCGAAGGGTCATAGAGTGATTAATACAATAGACAATATCTTTAACAAAATGAAAACAAAATATAAAATGGATTTTTCTTTGAAGGAAATCCAAAAACATTTAAATATTCCTGACTCAACTGCAGGTAACTCTGCTAATTCAAGCAGATAAAATTTTGAATCAAATTCTTAAGGTGATATTACACTAAGCTAACTAAACTAAAACCAGAGATTACTACAAATATAAGATTTTTCTGGCTTTGACTATGAAACTAATCCAGATTCAATAGTTCAAAAAATAAAAAACAAAGTGCTAAGCAGATAAGGAAATTAATTTGATATATAGTAAGAATAGGTAAAATATAATAGTAATCAGGCATAGACAACTCAAGAATTTAAAGAAAAGCTAATTGAGAATAAAAAAAATGAAATAAAAAAACGTCTTTCACCTTCAAGAGTTTAAAACAAAAATTCTATAAATTAAATAGATGAGCATGATGCTGATATGGAAATAGAAAGAATAAAAACTAGAATTTTTAACAGAAATTCAGAAACTAAAAAGACAGAAGAATCACCTTAAAAAATTGAATAAGTTCCAAATAAAATAGATAACCAAAAAATTTAAGAAATTGATTCTAAAGCAACCAAAAAAATTAATAAGAAACATCCAATTTACAATTCAAGTGATAGCAGTGAAGAAGATGCGAAGAATCCTAAAAATTCAATAAATTCATAATAAAAAACCAGCAAGAAAATAAATAATTAAGATTATTTTAAAAATAAAAATGACAAACTCATCTATGATGAAGAGGTAGAAAATAAAAAAAACTAAAAAAATGTTATCCCAACAAAAGAAAATAATATGAAAAATGAATAAGTTAAAAATAAAAAAATGGAAAAACATGAAGACGAAAGCTTAAAGGCATTAGAATAAATTTCATAAAATAAAATTAATTTTAAAGAAAACATAAAAAAACTAAAACAAATATTTAAAAATAACTTTGATCTATAAAAGTGCAAGGATGATGATGAAGAAGAAGCTTAACATTAAATTGATAAATAAAATTAGAATTTTAAAAATTATAACTAAATTCAATAGTACTAATAGGGAAGAGATAGTGAATTAGAGTACTCACAAGATCATTAAAATTTCTTTTATGATGAAGATACAGTGACTACCAAAGAACATATTGTGATAAATGATTAATCTGAGAATTTTATTGGCAAAAGAAAACCATAAAGTTATAACCAATAATTTGGAGTTGATAATGATGAAATTGCTGATATGGATAGCGAAGTATTTAATATATCTCCAGATCACCATCCGCAAAATGACCATCATTTAAATAGTATTCCAGATGAAAATCATACTATCAGTATATTTAATGAAAACTAGTCTCTTTAAGCTAGTTTTCTTGAACAAAGCATATTTTAGAAGAGCCCCAGATAATCACAAGCGGCACATTATAATAATAATAACACATTTTCACAACAAATAAATAAAAGAGCCAATTAAGGTAGTTCCCCTTCACCTATACTAAATACTTAGATTTAAGGCCAGATTTTATAAGACAGTTTTCAGAAAAATCCACAAAACTATCGCTAAAATAATTAAAAAACTATAAATTAACCACATACCTAAAATATTTAAAGCTAATCTGAAACATCTTTATCATAAAATAAAATAAACTAAGGATAAATAAATAATTCAGTAATTAACAAAACTTAGAATTATGTACAATCAGATTTATAATCTAGCTATCAACATAATAATGCTTCAAATCTCAGTTATAGTCAATCCATGCATGAACAGTCTTAAATATATTAGAACGAGCAAAAAAAATATCAAAGTGAGAGAATATTACCATTAATAGAAGAGGAGGATGAAAGACTATAAAAAATATATGAAACTGATCCAATCTTGCAAAAACTGCACCAAGAAAAAAGTGGTCTAGAATTTGAATTAAGCAAATGGGAAAATATATTGCAAGAACTTAATAGATAATCTAACCATCTTTAATGA