TTHERM_00353270

Length: 5787 bp

cDNA Sequence

ATGAGTGAAGAAGATCTATAATGTTGTGTCTGTAAATGTGGAGGAGATGAAATAGAATATTTAATAAGTTGCAGAGCATGCGAAGGAGAAAAAATCAAACAATTTTGTAAATAATGTTGCAGAAAACACTTGAAAGAAAGCCCAGATCATTCATCAGGGATGGCAATTTTTTGTCAAGAATGCGAGGAAGTCGAAATAGAAGCAACTTTTTACTGTGGGAGCTGTGGATAAAATCTATGCACAAAATGCGACTAAAGAATTCACAATAAATGTAAAAGAGCTAAGCATACTCGACAATAGCTGAATCTTCAAAGAGATCTTTTAATTGAAATAATTATTATCATTGATGAGAATTTAGCAGAAGTAATTAATAGTAAAAAAGTGGTTTATGATGGATTTATAGATAAATTACAGAAAAAGAGAATAAAATGCGATAGAAGCTCTTTGGTTGTAGTTTTTAGAAATACTTGTGAAGAAATTTTAAACTTTGATTTGAATTATTAATGGGAATAATTTGAGCGCTCGAACGGGCTATCTGAAAAGTTTCTTAATACGCTTAAATTCATGCCTCAGTTAGCAACATGCGTTTTCTTTCAAACTTAATAAGAAAGCTATGCTGCTGAGAAATCTTCTCTCTCATAATTGTTTCCTAACGTTCAAGTTATATTTACAAAGCTACCGATTTCCTCACCTGCAGTGTCAACTGATTAGTAAATAATATTATAACAAAAATAGTAGCAAATCTAGCATCTTCACTAAGTTTAATAGCAAATATAGCACATTTTTCCAATAAATCAAATTTAAATGAAATAAAGTTCTATCAATTCAAAGGCACAGTAATAATAAATTTAGCAAGCTACATGGAGTAACTAGAATTAGCAAGATCAATAACAGTAATTAGTTTAAATTCAATAGCAGCCATAAAGCATTCTTGCTCCATAGTAAAATACATAATTTATTGGAAACAATTCCTTCACTTAATAGCAAGCTCAATGTAATCAGCCTATTTAATATTGTTCAACAGCAGATAAAAACAACACAAATTTAAATTCAAACGGAAACATATAAATCTAAGTAAAAGCAAACATCGAGGAATCTAAAAATTCTTAAAATAACAGTGCAGTCTATAATCAAATAGAAGATGAATAAGCACAAAAAGTGGATTCTAAAAGTGTTAATGGATCTTAAATTTGCAAAAAGAAATATGGAAATAAAAGTTTAAATACAATTTTGAATCCTTGTAACTCATAAAATATAGATAAAAAAAACTCATAATATCAACATAAAAATTAGTCGTTTGACGATGGATTCTAAATTTATAGCTCTTCCGAGTCTCACTCAAACGAGGGCAATCCACCTTCTAATTTAAACAGTAAATTCCTGTTAATAAATAATAGCAACATGAACAATAGCTAAAATAACAGCAATTTAAGCAACAACAACATATTTAATAATAACAATAATATTATAACTGGAAAAGCATGCAATTCGAATAGCTTATATAATTAAATTCAGTAAGGAAGTTTAAGCAACAGTGTTTAACAAATAAACTAGTAAAATATAATAGGAGATAATAGCGGTATTGGCAATAACAGTCTTCTCAGAAATAACTAATAAAATAGCAATTTAAACATTTAGAATACGATAGGAAATACTAATAATAGCAATACTTTGAATATAAACAATAACACAAACAGCCCAAATTCTAATATCATGACTAAATAGGCGTCTTAAAGACCAAGAAATAACTCTTCAAACCATAAACATAGTCAGTAAACAAATAGTAACAATGTAACGAACCCCTAGCTAGATTATGGCAATATAAATAGCAGTATTAACAATACAAACAATAGCTTAAATTAATTTCATCATAACAACTCAAACAATAACAATATTTTAACCAATTAAATTACTAATATAACAAATCAAGTACTTTCTAAAAATACAGAAAACACAAGCAGAAGTAGTATACATAGCACAAAATAACCTTAAACTAATACAAGTGCTAATAATAATAAGAATAGCAGTAGTGGAGCTGGAACTTAATAAAAGTAAAAAAAATCCAAAAAAGCAAGCAAAGGCAGTAGTAATACCAGCTGTAACCGCTTATCACGAAACACAAGTAGTGGAAGTATTAGAAATTTAAACACAAGTAAAGGAAGTATTGATGGAGGTACTAATAACATATTAAATAACAGCTTAAACTAGGGTCTAAACAAAAATGCTTCATCAGGAGCTTTGGAGGTAAAGTCAAAGAATAGCCATAACACTTACACTTGTGGGATGCCATTCCAGCAATTTTAAAACCCAAAAACTGTGTCAGTTAAAAACTAGCAAATAGCAATTGGCATATAAAAGCAGCTATCTTTCTTAGCTGAGAAAGGAGAATTAATGATACACAAAGAAGTATTCTTGAAGATGGTTTAAAACAATATTCCTGGTTGCACTGAAAAAGACTGTGTTGAAATTTTCAATGAAGCAGAAAATGCTGGAATCATACATCAGACCACAAGAACATTTGCTAATTCCACCGAATTGCATTTTGTTAGTTTAAAGCTAGAATATATTTCATTATAAAGTCTAATTTGGATTATAAAATCAATTAAGTAAGACCTCATGACTCCTACTGATAAACTCATTTTAAGTCGTATAAAAGAATGTTTTGGATTAAAGCTAACTCCAAAAAGTTGGGATATGATTTTAAATCACTTGTAGCACCCAAGTTACATTCAAAATTATTAAAATGGATAAAATGGATTAGATCTCCCTTAATTAGTAGTACAAAAAGTAAACGATCCGTTGATGGGAGCAGATACTACTGTAATTTATATTAAAGAGTAAGAATGGATTCCAGAAGACAAGGGAAGGATAGATTTTGATAACGATAAAATGTGGAAACTTTTTAAAGAATTTCTAGACTAATACTTTAAACAACCTATATAAAACGAAGGAAGCGATGATAATAAATCAAATTCTTCTGCCTCAAGCAAAAAGAATTCTTATTTTACTACAAAAATCACAAAATCAAGTAAAAAGTAATAGGCCAATAACCAAAGTAGTTCAGCTAATCAATAAAGTTAGCTCAACTCTCAGGTGAATTCTGCTAACATTGCAAATGTCAATAATGCTTCAATTAACACGCAATCTTAATAAGAGTTAAGAGCAATTCCAGGTGGAAGATATGGATGTGTATAATATGTAAAGTATTGTGGACCAAGAGAACTGTAGGAGCTTTCGTTGGGTAGATTGAGTTTGTTTGTTTAGGAAGCTATCAATACAGGAATCATTAGATATCATAGAACTTTATTAGTTAAACATACATACAATGAAGAAAATAGTGTTTTGAATGAATCCAGCTCTGTGTTTTCATTAGAAAATTCTGTGCATATTTTAGAAAAATCTGCTTATGGACTTTAAAGAGATGTTACTGTTAAACACTTACAAGATGCCTTATTAGAAATTCTTTAAGAATATCCAAAAGGTGTATCTCTAGTGTAAATACCATAGTATCTTAAGAAAAAAGTATACTTCTAATTTAATCTGCAAGATCTAGGTTTTCCAAAATTAAAAAATTTTATTCAGACTATGAATGATAAGGTTCAAATAGAATTAGCTGGTACAAACAATTCATATGCTATTTTAAAATGTAATGCTTCTAAAAGCAAATGTGCTCCTTCTTTTTTACCAGAAAATAATATATCAGATTAATCTTGTACATCTTCTCCTTTATCAACAAATAATCAAGGAAACTTAGTTTAATAAAATGATTAAAGTGGAGCATCAAACTAAATAAATAGACAAGTATTTGGATTTAGCTAAGGCTATGGTGGAATAGGGTAAAATAATCAGTAATCATATGTAAATCAATAAAGCCAATAATATTGCCAAGACTTTTAAAATGCAATTCTTTAGACTCAGTGTGGTTCTAACAGTGAGTAAAACTAAAAATAAGCTGCTATTGTATTAGAGAAGCTTAACGAGCTTTTAGAAAAGGTAAAATAAAATATAGAAGCTATCCTTAAACAGAATCCAAATGGAATACATATTAAGGATCTTTACAGTGCATTAAGTAAATCAATGGGAGTAAATTTCTAGTTTGGGCTTTTTGGATCAATGGACTTTTTAGGATTTTTAACTTCTTATGCTGAATCAATTATTGATATAGAGTGTAAGTAAAATTACTATGTAATTTACCAAAAAAATCATAGATTTGGAACGGAAGGAAAAATAAATGGAAGTACTGGAAATCCAGCGAACACAACAAATAATAGTAAATTAAACTACAATACTAACTTTTAGGCACATATGATTTAAATGAATAGCTTGACTGGAAATGCTCAGCAATTTTAGCATCCTCCATTTTTCTAAGAGTTTTCTTAAAATCCAAATCTAATCAATTTTTAAAATAATTACATGAACTTAGCATCTTAAAATATGATGAATTTTTTGTAGCAGAATAAATAAGGAGGAAATAACTAAGTTTAGTAATTGACTTAACAGTAGCAATAGTAAAAGCAATCTGCTTAAACTCAGCAGAGCACAGGAACAAGCAACGCCAAAAAAAGAAGCATGGCTATTTCTCAGAGTGCTTCTAATATATTCAATAATGGAAGTTCTTCGTAAAACAGTAATAATAACCCAAATAATAGCACAAGTTCTACAAATTTTATTTAACCTCCAACACAGTTTAATAGTATGCAAGTTGGTCCTTAATAGTCTCCTTAATAACAATTCTTCATTAACTAATAACAGCAATTTTTACAAAACCCTAGCATTCTACAATAACAGTATATTTAAACATAACTAGCTTAGCAATATTAGCTTTTTGGATATGCACCTTATCCCAATAATCCTCAGATATCTCCAAATATGCAAACAAATCCATTTGGATAATCTGAAACTCCTTAGCACGTAAGAAGTCTTTCTTAGCACAGTAATAACAAAAACACTAATAGCAATCCAAATTTAACTATAGGTAGCGCAGTTAGATAAAATAATACAAGCATGACAACAAACTAACCAACTAACAACAATAACTATATAAATAATAATTAAAACCACATTTTTCATTATCACCCTCATCATCCACAATACTTATAACAGCATGGAACACAATTTAATAGCAATAACGGGTATTTTACACCATTCTATTAAGTGGATGTGTCATAATATTAATCTACTCACAGTAGAAACCCTTCAAAGAGTAGGTAAAAAGGGGAATAATCATCAATGGACATAAAGGAAAATATAGGATTATTGGAAGATATTTTATAAGATACAGAAGAAAATTATTCATTTAGAACTTAGACAGATAGAACTTTCATGGGTGATGATAATCTGACAAGCTTTAATTGGAGTATAAGCATTTTAAATCCTCATTATTAAAGTGACAGGCAAAGAGAAATTTCAACAGAATTTGAACAGTTCCCATGTGATCTAAGCAAAATCACAAACAAAGGTGGAGGTAGTGGGAGTGGTGGTTATTAAAATCTTGTAAGCTCTGCAATGAATGAAAGAATAACCACTTCAGGAGGAAATAACAATGGAATTAAAAATAATGGTATAAATCTTCTTCCTAATTATTAACAACAAGGTGGGTTACCTAGTTATTAAAATGTGTTAAGCTCAACACCCAATTCTTAGTAATAGTAATAATAGTAGTATATGAACTATTTTGTTAATCCTTAAATATATTCCTCTTCAAATAGCTACTTAAATTAAAATGTTTAATAATTCAATACTAATAACTCATTTACAAAAGAAAATAACTCAGAAAGAAAAATTTGA