TTHERM_00353560

Length: 774 bp

cDNA Sequence

ATGGAAAGACAAAATCTTTTGAAGTATGTCTACTCCAAAAATATCAACCCTAAGCTCAATTTAGCATCTAAAACAGCTAATATTGATAGCGAATTAGATGCCAGGGTGAATATTGTCCAAAATTAGAAAACTGATTAACCAGCAGAAGTCACTTGCTAGCCTATATATACTTAAATTGCTGCTTCAAGCGATACCTGCTCATTGGGCGGTCCTATTTCACCTTAAGGATTAATTTAATACCTTTTCAAGAAGAAAGAATCTGACTACAAGTACAAGCTTATCTTGAACAATCCTCTTGAATAACCCCTCTATAGAGAAAGAAATTTCAACATTAATGTCAGCTTGGTAGACAGAGACGATAATGCCGTTTCTAATAACAATCGTATTCCTCTCAATATTTCAATATACACCTCTGAAAATCCCCCAAAATTCATTGATACCAACACTTCTGGTAATAAAATATTGAAGGGATTCACTGAAAAGGATTTATAACAAGGCTAAATAACATTTGACAAAATATAGATTAAGGAAGTTACTAGCCACTTCCGTAATGGCTGGGTTTTTATCGTTATATTCCCCAAATAACTTAATTACGAAAGTGGAAAATCTATCCACCGTAAGGACGATATTGATATCAATGAAATTAGACCTCTCATTATTGAAAAAGTTGTTGTCAAAGCCAAAAAGCTTAAAGAAGGAAAGAAATAAAAGGATGGTAACAATAGTAATGACGACTCTAAAGAATAATCAAATGAAAAGATCGAAGATAATTGA