TTHERM_00353570

Length: 675 bp

cDNA Sequence

ATGTGCCTCTTAGACGCTAGATGTAGATGTGAAAATGGCTAATGCAGCCATATTGGTAACTAAATGCCATTCAACTAATTGTTTAATCCTCAATTCCTTAATCAAGATGCCTTCTAGGTCCTTGATTAAACTAAGAAGTTACTTAGCCAAAAGACCGAAATTATCAATCCTATTGTAAAAAAAGTGAAGCGCGAAAATGACTTTATTCAATAAGCTGAACAAAACGAAAATGTTAACAATCTCAACAGTATGGTTGCTGAAAATGTTGATAATTCCAACTTCTAATTCTAATAGAATTTGCTTCCTTTACTCAATTAATTCTAACCCATCAAGCCTGTTAACTATGGAATTGCAAATACTTCCGCTGTTGCTGCTAACTAAACTCAATAAAACAACAATTCTATCCAAAACAGCTCTTTCCTTATCAAGCCTTCACCTTTCTAGGCTTCTAATAATGGATTACCTACTGTTTCAAATAATTTAGAAACTCTTTTGAAAGATATGTAAGCTAGAGTTATGGGTATGTTCGCTTTCCAAAGCAAAATGTTAACTGAATTGTAAGAAAAGAGCAACATGCAAGCTTAAACAATCAATTTATTGTTCGATGAAGTCAAACAATTAAAGTAATATTTTAAATTCTCTTACTTATTAAACAATTTATGGGATATAATTTGA