TTHERM_00355270

Length: 702 bp

cDNA Sequence

ATGGAATAACTATTTACAAAGGTTTTAAACCCCAAGTTGAATAAAATATTAGCCATAGGTAAAAACTATGTTAAACATGTTAAAGAAATGGGTGGTAGTGAAGTTCCTAAAGAGCCTGTTATATTTTAGAAGCCCCACTCTTCTGTTTTACCTAATATCTAAAAAGGATAAAAGGTTTAATTCTTCACTAAAAATGAAGTTCATCATGAAATTGAACTCGGTTTCATGATGAGCAAAGAAGCTTCTCATAAAAGCTTTTAAAAATCAGGAGAAAACTGGTAAGATTATGTTGGGGGTTATTTCTTAGCTCTTGATTTAACAGATAGAAATCTTCAAGCTGCTGCAAAAAAGGCTGGATTCCCTTGGGATTTATCAAAAGGTTAAGATAAATTCTTACCCATAAGCTCATTTATCCCTAAAGAAAAAGTTCAAGATCCATACAATTTGACCTTACATCTCAGAATAAATGGAAAGACTATTTAAAAAGACAATACTGGTATTATGCACTTTAAGATCAAAGATTAAATCGAATATGCAAGTAAATTTATGACCTTATACCCTGGTGATCTATTTTTAACAGGAACTCCAGATGGTGTTGGACCTATTAAGCACGGAGATCACGTTGTTGCCGAATTACTTGAAGGAGAAAATGTTTTAGCATAAATTGATTTCGTTGCTGAAATGGTTGCTCCTGCTCTTTGA