TTHERM_00355520

Length: 627 bp

cDNA Sequence

ATGCAATAAAATATCTTGCTTGAGTCTTGCACTGAAAGCTATACACAAAGTTTAGAGGCTTAAAATAGAGGAGCTCATAGAATTGAGCTATGTGATAATTTAGCTTAGGGAGGAACTACTCCTTCTTATGGAACCATTAAAATTTGTAAAGAAAGATTGAATATCCCACAAAGTGTAATGATTAGACCAAGAGGTGGAGATTTCACTTACAGTAAAGATGAACTTGATATCATGAGAGAAGATATTAAAATTTGCAAGTAGCTTAATGTAGATGGTGTAGTTTTTGGATTTTTAACCAAAGATTAAAAATAGATCGACTTTGAATTGACTAAAGAGTTTGTAGAGCTATCAGCTCCACTCAAGGTAACATTTCACATGGCTTTTGATGAAGTAGATGACTAATTTTAAGCTTTAGAAAAATTGATAGAATTGAAGGTTACAAGAATACTAACAAAAGGTGGAAAATTTAAAAATGCTTTAGAAGGTTAGGAAGTTTTGAAAAAATTAATTGAGTAAGCAAATGGAAGAATTGAAGTGATGCCAGGAAAAGGAATAAATTCTTAAAATTATAAGCAATTAGCAGAATTTACTAAAGCTACTCAATTACATGGAACTCAAATAGTTTGA