TTHERM_00355780

Length: 1467 bp

cDNA Sequence

ATGTTTAAAAATCAACTTCTTTCCCTTAGCTTAAGAATCTAAAAACTTAGACTCTGCAGGCAAGGTAATTAATTGAAGGTTTTGCAAAAATCAATCAATCAATTACTGTTTAAAACATAATCTATAGATTAAATATTACAATATCTTTAACAAAAGAAAAAAACCCACTAATCGATTTTAGAAAATTAAAATCAGCACATACATTCAATTGGTTTAGTTAGTTAGTTAACAAACTAAAAAATAAATAAACAAAAAAATTAAAAAGCAATGGAGTTTAATTTCATCATTAATAAGTTAGTTTAATTGGACTAGTAAGGCCTTGGTGTATATATACCAAGGGCTAGTAGAAGCAAAGTTAGCAGTTAGCAAGAATAGTAGTTAGGATAAGTTTTAAATACGATGGGTGAAAGATCAGCGATAGCCTAGGGATTAAAGCAAGTAATAACAAATTACGATAAGGTATAAGGAACAGACTAAAGAGTTTACATAGTGGCAGAAGGTAGAACTTGCTAGGGATTTCTTAAAGTTGGATAAAAGAATCTTTTTTATCGAGATATGATGGGAAATATTAAAGAAATTAAGCCACTATGTGTGCTTGACTTTTATGTACATGAATCTTGCCAGAGATAAGGATATGGAAAACTACTTTTTGAGTACATGATTTAATGCGAATAAACCTCACCAGAAAAATTAGCATATGATCGTCCTTCTCCCAAGCTGATAGCCTTCCTTAAAAAGCATTATAATTTAGTCAAATACATAGCACAAAATAACAATTTTGTTGTTTTTGATTAGTACTTTAGAAGTGATGCTTCTAGTTAAAACAAATAAAATTAAAATACTCGTTCTTATTCTTAGCCTTACAGTGATTATTCTTCGCAAATTCCTACTAATTATCCTTAACAGCAGCAATAACAGTCTAATAGTAAATCTTATCCTTATAAACAAGAAAATAATATCGATTTAATGCAACACTCTTCATCTAGAAACAACAAAGAATTCTTGAATGCAGGCAGAGCTATACTATCAAAAGAAGAAATTTATAAAAAAGATAACTTAAGTCAGTAGAATATAGAAAATACCTTAAATAATATTAATAATTCCTAATATTCAACAAAAAGCCAACAATAGCAGTAATATTAAAAAGACTACTAGTTAGATAAGTATGAGAATAATTGGGGAGCTGACAAAAATATCAAAAAGCCTCCCTTCCCTGGATAAGATAGATAACTTGATAAAATATAGTAAAAAATATAGTAAACTGAAAGAGAGCTTGATGTCGTTAATTAACAAATTATTAAGCAAAGGCAAAACCTCTCTCAAGACCCATTAACATAAAACCATAGAGCATAAAATGTTTATAACACAAATTAGTTTGGAACTTCTCCATGGGCTCAGACAGGATTTAATTATTATTCAACATCATCTTCTAACTATGGAAATCACTACACATACTACAAAAAATGA