TTHERM_00365340

Length: 2520 bp

cDNA Sequence

ATGCTAAAAACTTTTTCATTCAAATAATATAGGGAAGAAAAGAAGGATTTCTCTACCGCTATCTTGGATAAGAAGAAAGCCCCTAACAGATTGATGCGATCTAGTTTGGCTTGTTAAAAGCTAAGCATCAGCTCAATATATGAAAGATTTAATCAAATCAAAGTCTTCAATATTTTTCGTTTAAAAAAGGTCGAAGATGCCACCAATGATGATAACTCTGCTGTTTGCATGTCTTAAAAGAAGCTCGACGAATTGGGTATTTTCAAGGGTGATGCCGTCCTCTTGAAGGGTAAAAAGCGTCATGAAACCTTATGCATTGCTCTTACTGATAACACTCTTCCCGATGATAAAATTAGAATGAACAAGGTTGTCAGAAAGAACCTTCGTGTTCGTTTGGGAGATATTGTCTCTGTTAGAGCTGCCGAAGATGTTCCTAACTTAGATAAGATTCATGTCTTACCCTTGGATGACACAATTGAAGGTATTACTGGTGATCTCGCCTCTACTTATTTGATCCCTTACTTCAAGGATGCCTACAGACCAGTCAAGAAGGGTGATTTGTTCATCGTCAGAGGTGGTTTCAAGTCAGTCGAATTCAAGGTCGTTGCCACTGAACCCAAGGAATATGGTTTGGTTGCTCCCAATACTATGCTCTTCACTGAAGGTGAACCCATTAAGAGAGAAGATGAAGAAAAGTTAGACGATGTTGGTTATGATGATATTGGTGGTTGCAGAAAGTAAATGGCTCAAATCAGAGAAATGATTGAATTACCTCTCAGACATCCTCAATTGTTCAAGACTCTCGGTGTTAAGCCCCCCAGAGGTGTCCTCTTATTCGGTCCTCCTGGTTCTGGTAAGACTCTTATTGCTAGAGCTGTTGCCAATGAAACTGGTGCTTTCTTCTTCTTGATCAACGGTCCCGAAATTATGAGTAAGATGGCTGGTGAAGCTGAAGGTAACTTGAGAAAAGCCTTTGAGGAAGCTGAAAAAAATTCTCCTGCTATCATCTTTATTGATGAACTCGATTCTATTGCTCCTAAGAGAGATAAGGTTAGTGGTGAAGTAGAAAGAAGAGTTGTCTCTCAATTACTTACATTGATGGACGGTTTGAAGGGTAGAGGTCACGTTATTGTTATTGCTGCTACCAACAGACCCAACAGTTTGGACCCCGCCTTGAGAAGATTCGGTCGTTTCGATAGAGAAATTGATATTGGTGTTCCTGATGAAATTGGTAGAATGGAAATCTTAAGAATCCACACCAAGAATATGAAGCTCGATGAAGATGTTGACTTGAGTTTAATTGCCAAGGATACTCACGGTTTCGTCGGTGCTGATGTTGCTGCCTTATGTACTGAAGCTGCCCTCCAATGTATCAGAGAAAAGATGGATTTAATCGATATCGAAAGTGATAAGATTGATGCTGAAGTCTTAAACGCTATGGCTGTTACCCAAGAACATTTCAAGTTCGCTTAAGGTCAAATTAACCCTGCTTCCTTGAGAGAAACTGTCGTTGAAGTTCCCAACGTTAAGTGGGACGATATTGGTGGTCTCGAAGAAACCAAGAAGCAACTCTAAGAAATGATCTTGTTCCCTATTGAACATCCTGAAAAGTTCCACAAGTTTGGTATGTAACCTTCCAAGGGTGTCCTCTTCTACGGACCTCCTGGTTGCGGTAAGACCCTTCTTGCCAAGGCTGTTGCCAACGAATGCTCTGCTAACTTTATTTCTATCAAGGGTCCTGAACTCCTTACTATGTGGTTCGGTGAGTCCGAAGCCAACGTCAGAGAAGTCTTTGATAAGGCTAGAGCTGCTGCCCCTTGTGTCCTCTTCTTTGATGAACTCGATTCCGTTGCAGTTCAAAGAGGTTCTGGCTAAGGTGATGCTGGTGGTGCTGGTGATAGAGTTATCAACCAATTATTGACTGAAATGGATGGTGTCAATGCCAAGAAAAATATATTCTTCATTGGTGCTACCAATAGACCTGAAATTTTGGATGAAGCCATCATTCGTCCTGGTCGTTTGGATTAATTGATCTACATTCCTTTACCTGATCAACCCTCCAGATACGGTATCTTGAAGGCCAACTTAAGAAAGACTCCTATTGCTAAGGATGTTGATTTGAACTTCATTGCCTCTATTACTGACGGTTTCTCTGGTGCCGATATTACTGAAATCTGCCAAAAGGCTGCCAAGTCTGCTGTCAGAGACTGTATTGAAGCTGAAGCCAGACTCAAGATGGCTGCTTAAATGAACCCTAACTAATAAGTCAATATTGCCAGCTACGATCCTGTTCCTGAAATTACTCGTAAGCACTTCGAAGAAGCCCTCAGAGGTGCCAGAAAGTCCGTTACTGCAATTGACTTGAACAAATTTGAATAATTCAAGAAGAAATTCGATCCTAGCTTTGCTAACTCTTCTGCTGGTCAATCTGGTCCTAAGATCAACTGGCCTTCTTCTAACTCAAGTGTATTAAATAATAATAGCCAAATGAAGAATGAAGATGAAGACCTTTACTCTTGA