TTHERM_00370840

Length: 1923 bp

cDNA Sequence

ATGATATATTCCAATTGCCCATTACACTCTAATTATGAGCTTTAATTCATTAAAATAAGGAATCTAAGTGAAATTGATGAACATAGTATATTTTATTGCGCTACTTGTTTAGACTAATTCAAAAATTAAGAAAGTAAAAACTTTTTATCAATATAGAGAATTATTTAAAGTAGCTAAGATTAAATATTACAAAAATGGCCTCCTTTAAATGATAATAGCATTTTAGAAGATTTAGGTTCTATCTTAAATGGTTTAGGAAATGAAAAAGATTTGATTGAAGATTTGAATTAATTTTTTAATTCATTTCTCATTTCAGTTCAAGAAAAAATTAATTCTAAAAAAGTTTTTTTCATAAGCAAATTAGAATAGGCATTCAAAGATAAAAAAGAAATGACATAAAGATATTTTAAAATCTCAAAAGTTGATGCTCTAAAAAATATCTTATAGAATTAACAAGTAGATTTAATTACAAAAGAAAAATAATTAAAAGAACTGCTTTCTGTTGTTAACAATGAAATTAATTTAAATACTTAAATTCTAAACTAATTTGTTGAAAGCATGAATGTTATTAAATAAATCAACAATTTAAATCTACAAAATGCTCAAAATCAAATTCTTAATTCTTTAGATTGCTTTGGCAATATAATTGATGAAAATGAATAATTAGAGTCTACAATTATGGCAGATAATAAATATAACTCATAAATAATTAAGCCATCTATTTCCTATGATTCATCTCTAGAAGAGCTTGATAAAATCTTAGATTTTTCTATTATTAATTCTAACAGTGATAGCAAAAATTTTTTATAAAAAAGCATTTATATATAAAACAAAATAAATGATTTAATTTAAACTTCTTAAATTAACTTTGTAGTTGACTCAACGTATAAAAACGAAAATGAAATAAGAGCCCAATAAATTGAATAATTTGCAGAGTTAAAATTCTAAGATGAAGAAAAAGTTGTTCAAAATCCATAGCCTAATGAAGAGTAAAAAAGCATGTGCTTTACTTATGATTCTTGCATTTCAAGTCTTAATAAAATACTCAATTATTTAGTTTAAAATAATTTAATAGAAGACAAAAAGTTTTAGTTTAATAATCTCCAATAAAATGATCTTTTGAAAGTAATTGACTTTGCTACTCATTTATAGAATTAATAAAATGAAGAATCATATTTAAAAAATGTATAAAAAACAAATCATGTGAGAGTATTAAATGATATTATATCGGAAAAACTATCAAGTATTTTTAGTCAGAATTAAATAGAAAATTATTTGATTGAAACATTTCCTTCTCTTGTAAGTAACTTAGATTCGGAATTGCTAAATACTTATAAATAGAACACTTCTTAATTGAAATACAATCTCATGCCTTTAATAGTATTCAAATAAGCTACAATGAATAGAAAATTAAATCCTTTGAATATCAAAAAATTGTCCAATGGTGTAATTCAAATTAAAGCAACACAAAATAAATATTACACTTAGTGTTTTTCAGATGTATTGTCTGCTAATGCTAAACTTGTTTTCAGATTTAAAATTGAATGCACATCTGGCTTAAAAAATCTTAGTTTGGGTCTTGTCTATGATAAAATGGTTTGCAATAATGCTCTAATCTGTGAATTAGATTGCTAACTATCATATAATAACAATGAATTGTTTGTTATTGGAGGAGCTATTTCTAATTCTCGTAAAAAATAAAATACATTAATGAACTGCAAAAGCTCTTTGCTTGAAGTTAGAGTTCACTTGAATAGCAAGCTACTAGAAGTTACCGACTTTCCTAACTACAAAAATAAATTTTCATTACATGAATAATTTATAAATAAGATAAATGATAAATAATTGAGATTATTTATTTATCTGAATAGCCCTTCCTTTACTATTTAATTACAGGAATTTTTTGCTGTTAATGAATACTGA