TTHERM_00370920

Length: 861 bp

cDNA Sequence

ATGGAAGAAGAATATTCAGAAAAGATAATTGGGATAGTGAAATCATACCAAGAGGGTATAACTTTAACTGAACTATTAAAGATATTAGAAGTTGATTAAAATGCCATTAAGCCAGAATTATAGAATTTATTAAAAGAAGGCTATTTAACTTGCACTAATGTAGGTAATGAATAAATAGTAGAGTACCATGATCCTCAAGATTAGAAATAACTAAATGTGGCAGCAAGCGATCTACCTCAGCAAGAATTTTAAGTTTATAAGATTATTTTCCAAGCTAAAAATAAAGGTATCGATAGAAAGGATATAGGCAATAAAACTGGTATTGCAACGGGAACTTTAACTAAAATATTGAATTAACTTAAGAAAAAAAATTGGATTAAATCAGTTAAAGGTGCAAATAGTACAGGAAAGGAACTGTCTGAAAGTATTTCAGGTGGTATTTGGTATAAAGATGGTGTCCTTAACAAAGATTTAATTGATGAGTTATGCTCAAAAATAGAAAACCATATGAATCATAATCCTATAATGACTGAAGAATAAATTATTTAGTTATTAAGAGTTAATAGCTCAATCAATTTAGAATAAAGACATGTACTATAAATTATTAATTTATTACTTTTCGATGATAAAATTGAAAAAGTAAAAACAATTACAACATCAACCAATTCAAGTACAGCTTAAAAATAAGGAACCTCATAAATATAGAAGTATAGATTATCAAATTGGAATAAATCTAAAGACCACATTTCTACTATCCCAGCTTTGACAAAAACTCCGTGCGGACATTGTCCTTTAATTAACGAATGTGTTCCTGGAGGGAAAATTTCACCAGAAAATTGTATTTATTTTAATGATTGGTGA