TTHERM_00374960

Length: 936 bp

cDNA Sequence

ATGTCATCAAATATAGAGGATTTAATGAATAAAAAGGCATAGGAAATTAAATTAGAAGAAAATAAATAAATAAAGCCAAAGATCCATTATAAAAGTTTTATAGCTGGAGCGATGCTTACATTTATAGCACAACCTTTTGAAGTATTGCGTACATCTAGCGTTTTTTTGAATCATTGGGGAACGAAACCTTCTGAGATTTTAAATCTATCTAAATTTATATATCAGAAAGAAGGTGTAAGGGGATTTTTTAGAGGAGGAACTATAGCAGCTGTAAAAAGCTCATTAGGATTTGGAGTATTTTTTAATGGTATTCAAAATATCCCTTATATACTTAAAACTTAAACAAAAAGCCCAGAACATTATATTTATAACTAAATTGTCAACTTTATAAATGGCTCGAGTGCTATGTTTTTTACAACTATGGCTTCCACTCCCTTAACAGTATTGAAGACTCGTTTTGAGGTTGTAGGGTAATAAGAATACACTTCTGTTATATAAACTACAAAAAAAATATACGCTGAAGAAGGCTTAAGAGGTTTTTATAAAGGAATAATTCCAACATTAATGAGAGATCTACCCTGGAGTGGAGCATAATATTCAATATATCAATCATTAATTAGTATGTACGAATATTTCCTATAAAAGCCAGCGAATGAAAATAATTTATTTATATTTTTATCAGGAGCACTCTCTGCAAGTGCTTCTATTATGATTTTCTATCCATTTGATAATATTAGAGTGAGATATTAAGGAGTAAGGCAATAAAATACTCCGCTTTTGAAGTTAGCATATCATATTTATTAAGTTGAGGGCTTTAAAGGCTTTTACAGAGGCTATTTACCTCGTCTTTTAAAGAAAGGTGCTTAGGGTGCTATTGCTTGGACTATATATGAGTATTTAAAGAAGGATTAGAAAAAAAAAGAAGCTATCAATTGA