TTHERM_00383490

Length: 2322 bp

cDNA Sequence

ATGAATTATCAGTATTTGCCTCAGCCTAGCCAAAAGTTAAATAGTGTAATTAATTACTTTTTGTATGAAGTTTCTTAAAATTATTTTCTCTACGTTTTGGACAGTTAAAAGTCAATATCATTGAAATTACTCTATGCATTATTCACTTTAATAACTTTGCATTTTAACAAAAAGGGATAAATTAAATAGTTTCAAAATAGCCAACCTGTAGGAAGCAATCACTAAAATAGCTATATTTAGGATTTAAATTAATGCAAAGAACATCCAAATGAGTTAATAACTAATTTTTGCAGCTGCTTAGAGTGCTTAAAGCCTCTTTGTCCAGAATGTGTGACTATCCATAACCAACAGCATAAATAGCAAAGAACATATGCAGAAATCGAAACCATTCGTAGCGTTAAATAAAGATGCGAAACAAAGCTTCTAAGTGCTGTTAATTTATTAGAATAGTAAATAAATAACTGCGAAAGAGCTCTTTCTGTTCCTGAAGGATCTTTGGATGATAACATTTAAATGCTAAGACGTTATAGGAAAAGAATAGATGATGTGATTGATACACATTTTAAGACAATAGAAGAATAAATAGTACAAAATATGAAAGAGTTAAAAACAAGAATAACAAATTTCGAGCCTACGTTTGCTAAAATGAAGCAAGTCATTACAGAGTTTTAGAGTTTATGTTAGCTTTTAAATTCAAATGATTATGTTGATATTGTTCAAAAAATATGTTAAATGGATGTATAGCATATTATAGCAAAGCACAAAGGAGAGATAAATAAAATAGCCTCTTCATTAAGTTATGAGTGCTTACTCCCAAAATTGGATGACGCTCGCGTTTATTATCTCGTTGAGGAGTTAGAGAGAGTTGTATCTGTTAGAGTTGCTGATGTGTAAGATTAGCTTTAGATGAATTAATTTGCATAGAACAGTACATAGAAATCTCCTTAAAAATACTCTCCATAGTAAAATATATCTATGAAGTAGTCCAACACAAATTATAATCCTTAGCAATAGCAAATTTATTAAAATAATAACATAAGTATAAACCATTCAAAATCAGGTTAGCAATTTTAAAGTATTCAAAATGATAACGAGTCTTAAAGATAATTTGTTTCAGCCAATTAATCGTAGCAGTAAAAGTACCAACAACAACAACAACTTTAAAATTAAATGATTTAGAATGAAATTTTTCAAATAACTGCTAACGATTACTTTGATAAGAAGTCTCTGAGAAAGTTCTTGCATTTCTTTTAGAACGATGACAATAAATTACATTATATAGATTTAACTGAGTTAGATAATTATGATTTAAAGGAAACGGCAAAATCGAGTAATCCTAGCAATTTATCTAGTAAAAGAGTGGCAGGGATTGATCAAATTTATAACATTGTAACAATTGATCTTAAAATATCATTTAGAATACCTTCATTCCACAAATCTATAGCTACTCCTATTGGAGAGCTATTTCTTACAGGAGGAACTATACCTGATGGTCAAATGAATAAGAGTGGCTGGATTTACCAATATGATTGGTAAAATTAGAGTCTCATATAGCTTTCCAGCATGAATCATCCTCGTAGTTCACATGGTATAGCATATTTAGCAGGTAAAATTTATGTCGTAGGAGGTTACGAACACAAACATGTTATGACTAAAAGATGTGAAAGATTTAATCTATTGACTAAAAAGTGGGAAATGATATCTAATTTGAACTACGCTGCAACATCTTTGTCCTTGTGCAGCTTCAATGGAAGGTATCTCTTCAAATTTGGAGGAATAGGAGAAGGATATGACAATCATCTCCTTAGTCCATATATAGAAAGGTATGATCAATTAACAGATTCTTGGGAGGTGATTGATCCTAAGCTAAGTTAAGTTCATAAATTGAATAAGATAGGATTCAACTTTGGTCTGCTAAGTACATCTGCCTCAATATAAATAAACAAAACAGATATATTTGTTTTTGGTGGTTATCACGAAGATAATTCTGGATCAAACTAATCCTTTATTTTATAAGTTATTGATGAAGATTAAAATTAGAATGATGAAGAAGAAAAAGGTTACGATGATTAACAACATTAATACGATTACTAGGGATAGAATTAAATGTATAAAAACGAGGTTTCTTCTTAGTATTTTATAAAAAACATTAATTCTAAGCTTCTCCCTAATTCAGAAGCATTTTGGAATAACGTGCCAATAATCTTTAACAAAAAGGTGTATGCTCTTTAAAACATAGCAGGAGAAAATTCAGATAATTGCCTTGAAAATGAAAGAAAAATATTAGCTTTTAATGAACGTGAATGGAAAGCTCTAAATTGA