TTHERM_00391520

Length: 2304 bp

cDNA Sequence

ATGGGACTGTAACAATCAAAAGGAATCATTAACCCCACACACAAGGTTTAGGATGATGATATCAATTTAAGAAGGTAGAGATCTTTATTTTTCCCTTTAGGTGAAAATAGACGCATAAAGACAATTGACTACCTTCTAGTTGCTTGCGATACTCTTGAAAGTGGTGGTGTCGAAAAAGATTAGAGTTCAGTATTAAATAAAGATTTGTAAGAAAAGAGAAAAAAACTAAAAGCTACTTCATCTGCTAATCTGTAATTGATTGAAGAAGCCTTTAAAGAGTATGATTACAACTACTCCAAAAGCAATGTAGTTAAAATTAACTTTTAATTGCAGAAAAAGTCATTCGATGACTATCTAAATGATTTATTTAGTAATTCAAACACCAATGGATTCATCCTCTATTTTACTGGACAACTTACTGAGGCTTAGTAGCTAGTCATCAATTAGACAGAAAACACTGCTGTTTTCTACGACTTTAAGAATATCATTAAACGCTGGCGTAGAGTTCCCAATTATACCAATAAACATCTTTTAATTATAGTCGATGCTGAAAACTCTGGCTCCATTCTTGCTTTGAACAAAAAAGTACATTTAGAAGAATATGAGGATATCTTTGGATTAGATTAGACAAATGAAAGCGAATTCAAATACAGAAGAGATCCTACATTTAGTATATTCGCAAGCCAAACTCAGAGAAGCAAAGATAAAGAATTTTACTTAGGTGAAAGTCCTAATAACAATTTTTAAGGAGACTTTAAGAATAACACAAGATTACAAAACAATGGAAAGGGTCCTAATAGCTTTAATGATGCTTCTGTTAACCATGTTGAGATAGATAATGAAAAAATGCAGAGTTACATTCAAGCATCAGGCTTTACAGCTTTATTTTCTTAATATTTAAAGAGTGGAAAACCCTCAAGTATTACTGATATTGCTAAGGCTAAAGATATTTAAACCGTTTTAAATGATAATGATCCTTTCTTCTTCGGATTTATGGTCAAGGCTTACCTCGATTTTGGTATCTTCTTTTGGGCTAGATACTAGAAAATGATTAACTAACTTGAGTTAAATTGCTATGTAGCTGTTGGATTGACAATCAAAAATTCAAGTTAAGCAAATTCAAATAATGAAAAAATAGGTTAATTTACTTCATAGATATATCAAGCCATAACTGACGACTAGAAGTTAATGTTAGCAAAAGATTTAACAGAAACACAAAAAGTGTAAGGTCTAATGAGTTCCCCTTAAAAATCAAAAGTTTCCACACTAGCAGAGTTAGACAGTAATAATTATAGCGATTTAGAATCGAAGTTACTTCATAACAGTGTAAAAGGCTAGTACTTTGGATTTGTTGGTATTTTGAAAAAGGATAAGAAGTTTGGTAATCCATTATTTTCGAAACCAGCTTAAGCACCAAAAACCTCAAACCAATTAAATTTGATTAAGTCTATTGATAATCTAGATGTACCAGAGAGCAACAATAATCTCATATCTTCCCTCAATCACCTAGAAGTAAGCTCATTCTAATCGAACAATGCCTTTAAATCCACCATACTTAGAGGAAATTAAAATTTAGATGAAGGAAACATAGTAAGAAAGCATTATGGAATGTAAGAATACTATAAAGAAATCGAAGGCCAATAAAATAAAAGCGAAGCACAATTTTCTGAATTGTACGAAGGCATGTGGAATGAAGATAAATTCAGCAACTATGGTACTTACTACTATTCAAATGGAGATAGATATGAAGGTGAATATAAAAAAGGCATGAAAAGCGGTTTCGGTATATATTATTACTCAAATGGAAATATCTATGCAGGCAACTTCGAAGAAAACTAAATGGATGGAGTGGGAAAATTCATCTTCACAGACGGTGAGATCTTTATTGGAAATTTCAAAAAAAATAAAAAAGAAGGTTTTGGAATCAAAAAGTAATCTTATGAATAAGTAGATATGATTTTATCAGGCAAGTGGATCAACGACAATCAAAATGGTTAATTTAAAATAACATTATCTAGCCTAAAAGATGTTACAATGAATGCATTCTTTAAGAAAGGAGAAATTTCAGAAAATGCAAAATATACAGTTAAAATATCTCAAGATAAAGAAGTGAGTTTCAATGCTAAGTGGATTAACAACAGAAGAGTCTAAGGTTTCTAAATTTAAGAAGATCTTAAGAAATAAGAAAGCGAATATTCTCAATACTTGAATAAAATTGAATAGTTTGATAAGGAATATATCAAATTCATTCCTCCTACTATTAAAGTTGAATCTGATGTTAAAAATGCTAATAAAAATGCTTGA