TTHERM_00393080

Length: 840 bp

cDNA Sequence

ATGGGATAATCATAAAGCCAAGAAAATGAAGACGAAAAGGAGGATAAGACACAGAATGAGAAAAAAAAGTCAGAAAAAATATAAATTAGTCCTTATGTAGATGGAATGCCCGTTTTGCAATCTAAGTTATAAAAATTAATTAAAAAAGAAGATAATGAGAAATAGCAAAATAATGAAGTGTATCAGATGAAAGAAAGCAAAGAAATAAACACAGATATCCATTAGGAAATACAATTAATCGAATAAAATAGGTTCTAAAACTGCAGTGATCATATAAGACAAGAATTTGAAAGCTTTTCCAATGAAAATAAGATGAGTTAGCGCAAGTTACTCGAGTATTTCGGACTCTAAGATCTTGAAAAGCAAAGACTAGGAACTAGGTTTTTCTTAACTTGTAAAAGCACATTAAGTTAAGAAAAGACAGGCCCTTATCTAGACTACAGCAAATTCTTAAAAACATTATCGATGCTCTCTGGAAATAATGAAGATGGGAGATTTTAATTTTTATACTAGCTCTTTGATATAAATTTAGATGGTAAAATTGAAAAAGATGAAATGAGAGACATCCTCCAAATGATTCTTGATGCTCTACTGAGCGTAACTTATGAAGATGATGACTTGAAAAATTTATCAAAGAAAATACAAGGAGAGTAAGAAAGGATGATAAGTTTGGCACTAGACCAGATAACTTCTGAAATATTTGACTCGGCAAATGAGTCAAACAGTATTAATTTTTAAAAATGGAAGAATTGGATATCCTAAATAGAAGGGTTTTAGTAAGTTATAAGGTTTGATCCTCAAGCGAATAGCAATAATACTTACACACAACAAAAAAACTGA