TTHERM_00394650

Length: 1896 bp

cDNA Sequence

ATGGATTAATAGCTGCGCAATAGTCCTTCAGAATTAAATCTTGATTCTATCAATATCAATGATGAAAAATATAAAATTAATCAAACTGATTTAATTGAAATGAAAGAAAAGTTTGATTAATTTTCGAAATTAGGAAACTATTACAGTAAAAATGATATCGTAAATTAATTTAAGCGATCACTCATTTGTCTGAGTAATGCATAATAGAATTAGTAGAGATTTCTTCAAGTTATTAATAGTTAAGAAAGTAAATTCTAAGCAAAATAAAAAGGACTCGAATAAGAGTATTAAAGGCAAATAAGTCAGCTTAAGGGTGTAATTTAAAATCAAAATGAACAAATCAAAAATTTATAAGAGAAATCTTAAACTGATAACAATAATTTATAATAGTAATTAGATGAAAAACAAGTTACTATTATAAATTAGTAGAATTAATATGAGATGAAGTTGTAAGAACAAAAAAATAGCTTTGACTAAATAATAAATGAGCATAAGAAATAAATAGATTCATTGACAAGCTAGAATAAAGATTTAAATCAATACAAATCCAAATATGAAGAGGTGCAGTCAGAATTAGAAAATTACAAATCAAATTAAAATAAATAAGAATAAGTTAAAAAGATATTTTAAGAATTTTCCGTTGACAGCAATCAGCCAGGAGATATTGATAAGTAAGTTTAATAGGTTCTTGAGTTATTAAATCCTCAAGTTGAAATATCAACAAACTTAGTAGAATTCACTAAAGCGCATTAAATTATATTGTAAAATCAGCCATCCGAAGAGGAGAAGATTAGCTTATAAGCTAAAAATGACGAGTTAGTGTAGATGTACAATGATAATTACAAAAAAGCTCAGCAATCTTTAAACTGTATAGGAGAATCAATGAAATGCCTTCTAGCTTTATAAAATATGTATCTACAAGATGGAATATAGACTTTCTTAACTGATCAGCCTATTTAAAATTTGGAGAAAGAGCAGAATTATTAAATATAATAATCATTTTTACAAGTTGGTTTGCATAATTAAGCTTCTTACTACTCTGCAATAATAAATAGTCATTCATATCTTTATTAGAATTTAGTAGAAACCAAAGCAAAGGAAAGTGTTAATGAATTCTTAGTGAAATTCAAAGAACAAATAGGATAAATGGTAAACTCTGATAATCCCAAACAAGATATTACCATAGTCAAAATATCTTTTGATCAATAGCCTTAGGTAGACTTTTAAGTTGTTTCTAAGTAGTTTAATCATCAGGAAATCAAAAAGAAAATATCCTTATAAGATATAGGAATGTCTTTCAGTGAAAAAAGTCTTTTAGAGGGCGCGAAACTATCTGTTGATATGTTTGACCCATAATTCAACATGGAATGGGGGAAAAATTTCTAAGGATAGAGTACAAAGAGAGGATAATTGACACTGTTTGACTAAGTAAATCCAGTTGACCACCTCTACTACTTCCCTGTTGGTTATAAAGGCTATGCATTAAATATTGACAGATACGGATATGACAAATCCTGGATTTCTTCTAACTCAGACTCTAAAACATGGATAGTCTTATACCATGGGACAAAAGAAAAAGCTGTTGAGAATATAACAAAAAATAACTTAATCGCTGGATAAAATAATGCATATGGAGGTACAACCTGTAGGATAACAAACACTAAAATAAAATAGGGTCCAAATGCTAATATATATTTAACTGATGATTTAGCTGTAGCTGAGGAATATGCCGTAGCTACATCTGCTCATGATGGAAAAAAATATCATGTAATATTTTAGTGTAGAGTAAATCCATAAGGAGTTAAAAGTCCAAAGCTAAAACCAAGCTATTACACAGTTGAAGATAATTTAAATATTAGACCTTATAGAATCCTTTTAAAAGAATGCAAATAATGA