TTHERM_00394700

Length: 1845 bp

cDNA Sequence

ATGTACTAATTTTAGAAAAAAAATGATGATAAGTTGTAGCTGACTAGAGTTCCTCTTGAGACTTTAACAATTCTTCTACTTCTATATATTAGAATGAAGCTAAGTAATACTCAAAGCTTAAATATTTAAAACAGTGACAACAATGAGCTTTGCAAGATACACAAAAGGATAATAGAACTATAGTGTCTTAATGATAAATGCAAGTTTTTTAATTAAAGGGGATGCTCTAAATGCTTTCTTTAAGGTTAAATACATGAAAATTGTGAATTAATTACCTAAGAAAATTATGAACAAAATAGCTAACACTCGAAAAGAAAGTGTATAATTTCTGAATTCGATAATTAAATGAATATTTTTATGAAGGAAGTCAATACTTACTTGATAAAAATAAAAGATTTGATACTCAAGTAGATTTAACTCGGTGATGAGTAAGCTTTTGAAAAGGCATCTCATTACATCGAACTCCTTAAAGATGTCACTTATTTGAATGGACAATAAAAAAATTAACAACTGAGTGATGTCTTTTTTTAATTAGAAGAAAATTAAGAGTTATTGGAAGACGAATATTATCTTAACAATTCAAAGAGTAAATTAGCAAGCTAAAGTCAGTCAAAAAGTGATATTTCTATTTTAGATTAGTCTTAAATTTCATAAAATTTAGATGCATCTTCGATATCTGTTGCTTCAAATAACAGTGTAAGAAAGAAAGTATTACTAAATAGTAGTAGTAGAAGACCTACTTAAAATGAATAGATTAGAAACTCAGAAATGGAATCTTCCTCTTCTTAGATAATTTCATCTTTTAATCAATCTTCTTCATTTGTCTCTGATAAGATTGCACCAAAACTGACCCAAGTAGAAACTTAGTGCAGGTATATGTCTTTAGGAGACTTTAAATTCAAGTAAACTTAGAAGATTTAGATAACTAGTGAGTATATTGAAGACTTTTGCTTATTTGAGACTTCATAAAGTCAAGATATGAATAATAATTAGCCTATAATGAGAGATTTTGAAAGCAATTTAATTTAAAAATCAAAGGCATAAAAATAGTACTATTTATTAACGAGATGCAAAAGACAAGCTTTGTAAGTATTTAACTTGTAAAAAATGAGATTAGAAAGAGTTATTCATTTTACCAATGACAATGAATTAATTCAATTTAAGCAGATTAGTGATTCAGAAGTGGTTATTTTCAGTCCAAACAATAAATTCTTTTAAGTTTAAAGTATATTTGATGAAAGCAAGTTTTAGCAAATAGATTTTAAGTTTAACATCGATTGCATTGAATGTGATAAAGAAGAACAAATTATTTTCATAGGACATCAGCTTGGTAAAATATCGGTTTGGGATATGAAAAGATAGCAAATGATACTAGAAAGGAGACTGATAACTTGCTGTGAAAGTGGTTCTGTAAAAGAATTTTTGTTTAATAAAAACAATCCAGAACTGAGATAAAAATACATTTACAGAAAAGAAATACTATCAGATTAAGAACTTGAGAGCATAACATGCATAAAAATAATAAATGAAGACACCATTTTGGTTTAGTTAGGAGAAGAATTTATAGAAATATATAAAAATGGGTAAAAATTAAACGAAGAATGCCTAGAATTTATGTCTTGCTTGTAAAATATGAAAGTTTATGACAAAAGGTATTGCATAATGTAAAACACAGAGAAGGAAAACACCTTTTAAATATTTGATTTCAAGAATTTTTCCTTCATAAGGAGACCAATATAACTTTAAGTTAAAGATTCTGAAGATTCAGAAGTAATAGGAGCTTACTATGTGAATAACTCAATAATCCTTCTCCTTTTAAATGAAAAAATCATTAAGTATTTTTGA