TTHERM_00398070

Length: 2106 bp

cDNA Sequence

ATGTTAGAGAGCACAGCCACACCTATGTTATTAAAGAACCGAAATAGACCTGGGTTCAGTATGTTAAATTAAATTAAAATGAATGAAAATTCATTGGATCATTAAAGCAGGTCAAACAATCACGCTTTTGAAATCAATAAAGGAAATAGTCTTTAATACTTAAAAGAATTGAGTGCTTAAAAAAAAATAGACTTTGCGAATTTAAACAAAAAAGAAGGAGGAGATAAAAGGGTTACTTGGAGTCCTTTTATTACTTAGAATAACTTAATATAAAATAACAGAGATCATAAAAGCGAGGGCATTTCAGATCTCATGCAAAGTAATAAAGAAAACTATCAAAATATTATCAATAATAACAACAAAAATAATGTACAAGAATTTCTTTAGTCTGCTCTAAAATAAAAATAAAAGAACAAAGTTACGTTCAAAGATGACATTTTAGAAACAGAAAAAGCTATTTAAAATAAATTTTTAGCAACTCAAAATTAGCAACAAAATAAATAAAAATCTGCTTCTTAAAGTTATCCAGAACTATTTAAAAATTACGCACAAAAACTTGACAGATATTAACACTATTAGCAACCCCAATATTAAAATTAAGAGATTTTTCATGAAAATATTGAAAAATCCTACATCTAAAACCATGATCAAATCCCAGAATGGAGCTCTGATGCCCTCTAAATAGCTAAATCAGCAATTAGAAAGAATTAAATTTTTACTAAGGCAAAGTTTATCAGTTTGAGCTTTGGATTTGCAGTAGCTATCATATTATTATGCAGCTTATTTATTAGCTTTAAAACTCTAAAGCTCTTCAAGATATTTGTTCTTATAGGAGCTGTTATTAGTCTAAGAACATTAGTTTATGAAGATTAATTTCAGAATGTCATGAAAGATCTAGGCTTAAAAGATTTAGGAATATTGGCCTCGATAGCTATGATTGAATTCTTTTGCATGATGGGATTTGCTTCTGAAATATTTGCTGCCATACTTCCATCACACTTACAACTAGAAATATTTTGGGTTGTCCCAAGTGGGTTCTTGGCTTTAATGGAAACAATTATTTATTGGAGAAAGAGCTAGCAAAACAAAATAAATGAAGAATTTCTGAATATAAAATGCAACACATTTGAGATTCTTAAGGATAGTCTAAAATAATATTTCTAAAGTTTCCAGTTTTTAAAGGATGCTGTGACTCAAGCTATTTCAAGTGCTCTGATTGTTACATGCTGCTATTATTCTAAGATATATTATCACGAATAACAATTAATGTAAAATCAATACTTTAAAAAGGAAATGTTATTTAATCTAAACACCTTCCCTGAAATTCTACTTGATGACTATTACATCTACATTATATGCATATCAATTCTCTGTAAAATCATCGTATAGTTTTCTTTGAATTTTAATTATGAACTTATGAGATATTCTGTAGTCAGCTATTTGGGTAACTATATATGCTTTCAACCTCTATATACAATCGTCTTTAAATATCCTATTGCTTTTTCTGACTTTATTCAACATGAAGCAATGAAATACTGGTATGCCTACTAGACAGTTCCGTTATCATAGGTGATAGAAAGAACTCAATTTTCTAAAAATTTAACTGAAAATGAAAACAAAGTTTTAGATACTATTTTCGAGTTTATTTCTAAAGAAATGAATAATACTTTGATTGCTTTAGCTTCAAATGACCAAGAAAGCTTTTAAAAAAAGAGAGATATCACAAGTTTCTTCATTAAAAATAGGAAAATATAAACTTTATTAAAAAAACAAAGATTCCTTTAATCTATTTTGAAATTCACTCTAATGATCATTTCAAATAGTGCAAAAGTGTTTAACTTAAAAGTAGTTGATTTTATATAAACTACTTCTTCCACTCTGGATTAACTCATTTAGCTCTTTGAAAAGCAAGGAAATTATTTCACAGCAGAGATAGCAGATATAATTATTTTAAAGAAAGAAGTTGTTTCGAATATTCAATATATCTACACTAAAATGAATAGTACAGTTAAGAGTTAGAATCTCAGTGCAATAGCATTGTCAATTATGATAGACTCAAATCATATCTATAACGAATATGACCTTGATTCAAAGTTTGTTTGCTGA