TTHERM_00399450

Length: 324 bp

cDNA Sequence

ATGTTCAATCCCTTTAGCAGAAAAGATTCAAAAGGAGAAGCCCATCAAAACAGATAAAAAGCAATTGAAAAATTAAGTGTTTTGTAAAATAAGTAAGATGCCTTTATTGCTATAAAAGAATTAGAACATAACTTATATAAGCATTGCTTTAAGAAATGCCTTAAATTAGATGACTAGCTATTTTAAGATGAAGAAAGAGATTGTTTAACAAATTGCAATGCTAAGATTGCTTAATTCCTTTAAATTTCCAAGGATAATTTCTCAAATGTTGAATAAAACATCTAAGTCCTCAAATAAATGGTAAAAGGAAAACCTTCTATTTGA