TTHERM_00402060

Length: 777 bp

cDNA Sequence

TACCTAATAAATAGATTAAGCATTAAGTGGCACATTATCAATAAAACATAATAAAAAATATCAATTTTAAACATAACTTCAAACTCATAATTAGCATTATAAGGAGTATTAAACATGGCTGCTACAACTTAAGATTATGGATTAATTGAAAATGCTATTTTGAATAATATTTAGATCATAAAAAATGACTTTATGCTTCTACATTAAAGATAAAAGGGAATGATAAATTAACTTGAGAATGATTTCTTGCAAGCAATCCCAGAGAAAATAAAAAATATGTCAGTTGCTGATTTCTTGTATAAATTTGATGGTGACCTGAATAAAGCCTTTTGCTAACTCTCAGTTGTTGATTTAAATTTAAGTTAAACTCTTTCTAATGCCTCTACCCTTCCATTATAAAATAATACAAATTTTGTTTCAAATAATAATAAGCTAATATATAGTCAAGTATAATCAAGCAGCTTTATGGAGAATTTTCCTAAAAGCAATAACTACAACCCAATAAACTCAAGCAACAGTAAAAGTATTTTGAAAAACTCTAAAAGAAAAAGAAACGAGTACGAATAGAACTAGAAAAAGCTTCTAAATAATCTATATCAGACACACCAAAATAACTATTCCAATAACAAAGAAAACTTTTCACAAAATGGAACATCTCAAATGCACTTCCAGCAGTAATCGAAATAAAATACAGCTAAAAAAAATAATAATACTAACAACAACAATTAAAACTAAAATACTACTTCAAAAAGCGGGAAAAAAATCTGGAAATTTTGA