TTHERM_00402090

Length: 1155 bp

cDNA Sequence

ATGAAAAGTATTTTATTATACACTTTATTTGCCCTAATATACAGCCAAGTAAAAGCTCAAATTATTTTTTTTGAGTAAGACTCTTAGTGCAGATAATATGTCTCTTTTAATTTTGGAAGTTCAGACTAAATTATTAAATTTTAAATGGAACTGTATAGTACTATTTCATTTGTTTTCTCTACATCTTGTCCAGGTAATTAGTGTGTAAGTAATCAAAAATTAGACTGCTAGTCATCAAATGGGTGCAAGGTTTCTTCATAAACAGAAAATATAATTAATGCTGCTAATTAGACAATATTCTACGCAAACTAGGCTACTTCTTCTATTTTTTGCTAAGGTTGTAAAGAAATGTCAATCAAATAGTTAAATTTTGATTTTGTTTATAGTGCTGCAGCATACCAATATTATGATTATGCTATGTTAGGATTATTTCCTAGTAATTCATTTTCTAATTTCTATAATTAAGTTTAAAGTGATACTTACCGCTCAGAATAAAATCTGTGGTTTGCATTAGCAAGCTGCTATAATAAAAACAGAGATCTTAATACTGATTCATAGATGGGATTCTTATCATTTAATGAAACAATCACAAATAGACAAACATAAAGGATTTTTCCCTTACTTAAATCTGATACAACTTAGAAGTACTTTTAAGCAAGAGTTATTTTTTATGATTAAATCTTTGTTGGATCATATTAACTTTAAAATAATTATCAATTTATCGAAGTATATTAACAAATATTTGATAATATAGTAACTAGAGTATCCTAAAAATATAGAATTTAATATGCAACTGCCTAATAAGATATTATGGTTTTAACATGCAATCCTTGCTTGGATTTAGATGACATGGTTATTTTAAACACAGTCGATTAATATTAGTATAAGCCTATATAAATTAATAGAAAATACTTAACCACCTCATATAATTCTAGTCACTCTATTTTTAATATAATAGCTTCTAAAGAATAAGTTTTAAATATGGGAGTACCATTTTTTTACGATAATGTCGTACTCATAGCTGGGAGTGTTATCAATGTTTACGACCAAAAATACCCTGATGCAAATACAATTATTTCTTCATCTTCATAAATTATTTCTTATTAAATAATTTATTTAGGGCTTCTCCTTTTAGCATTAATGATATTTGGCTGA