TTHERM_00411540

Length: 882 bp

cDNA Sequence

ATGGCTGCTATAAGAAAGAAAGTTTTTATTTTTACTCTATCTGGAATGACTTTGATGACTATGTCCGCATGTAGATGGTAGTATAATAGATATCACTACTCTGTCAATAAATGGAAAGTGCTAGATGAGTAGTTCAAAAAAGAAGAACCTGATCAAATTTAATTTAGTAATCTGCCTTGGTAGGAATAACTTGCAAAAAATAATAAACTCAATATTGAAGACTTTGAATATAGATTAATTAGACTTAAAGGACTCCTTAAAGGATAGAGATTTTTTATCCATAGACATTAAGATGGTAGACCAGGTTATTTAATAGTAGCTCCATTTATAGATTCGACATAAAACACTAATAATGCATTAGTTGTCAACTTAGGCTGGATACCAAGCAATATGAAATAAAAGTTTGATAATATAAAATATAATGACGAAGAAATAGAGCTTTCTGCCTTAATTAAACGCCCAGAAAAAATAGATTATGTTAATTAGTAGTAAATTTAGTCTATGAAAAAAATGGAATAAATGAATCAATCTACAAGTAATTAATAGTAAACCTCCAAGTAGCAGAATCTTTAAAATTAAGATAGTGGTAAAATAATTCCAGAATAATCGAGGTTCAATTCTTTCATTGATCTTGAATTCCTCAAAAAAGAATTCAATTGTAACTTAGATACAAATGCATATTTAGAAAAATTTATAAGCAGAAAACAGTATAATTAACTCAGTATAAGTGATTCTGATGATGATTTGTATCCAGTATGCTCATCACCTTAAACATTTTCCAAACCTTACTTAACACCTGATAAACATTTAAGTTATTGCACTTTTTGGGGTTGCTGTACAACATTCGGTATAATAACTATCATAAGAGCTTTAAGAGTATGA