TTHERM_00418280

Length: 2667 bp

cDNA Sequence

ATGTTATCTAGAGGTGTTAAAAATCTCATTTCACTCCAAAAATCTTACTTGCAATCCAAAAATTTTATTGGATTGACTTTAAGAAACAAATATTACTTTAGGAATAACAACAATGATGAAGGCGAAGATAGAGCTCCAGAAGGGTTTGAGAAGTTCAAAAGAAGGTCTAAAAAGAAAGCTGATTAGTCTTAAGGTGAATAGACTGTTGAATAGCTTGAAAAGGAAAATAGAAAAGATAAAGAAGAAGTTGAAGAAACAGAAGATGTAAGCGCTTCAAAGTAGAAATAGGTTAATGAAGAAGATGATGACCCTTTCAAGAAATTCAATAGAAAAAGCAATAATGATAAGTAGTCATCTAAATCTAGCAAGTAAAGTGTAGAGAAAAAGGAAGAATCTTCTACAGAAAGCAAACAATAAGATAACTAGGAAGTTAATAAAGATGAAAGTGATAAAAATAAGAAAGATTGGTCATTTACATATAGTCCTAAAATCTTTGGATTCGAAGACAAAAATTCAAAAAAGAAAGATGAGTAAAAAAATAAATAAGAAGAAAATCAAAATGAAAAGAAAGATGATGAAAAAGAAGATCACAATGAGCATGAAAATAAGCGTAAAAATGAAGATTCTTCATAATCTGAATTTGCCAAAAAGTTTAAAGAATTCTGGAATAGTGGAAACAATAAAAAATATATCAGTGCAGCTATTGCTATTTCTATCTTAGGACCTTCTCTCTATTATTAATACGAAACTCAACAATATATATCTTATACTGAATTCTATAAAAATTATCTTCAAACTGATAATGTTAGATCTATCGCTATATAAAGATTACCAATTGGAAACAATTTGAAAACTTATGCTAAAATTGTAACTAAGGATGGATCAGTTAAAAAAATTGTTTTAGGAAATGTTGATCACTTCCTTGAATAGGTTGAATAATACCAAGTCGAAAAAGGAAGAGATATTGAAACTCTCATTCCTATTTCATTTGAATACCTTGTCGATTTAAATAAAACACTTGATTATTCTTTCTCATGGTTATCCACTATGGCAACTATTGCAATCGGTTACCTCTTCTACAAATCCATGAAGAGCGGTCTTGGAAGTATGAAGGGTGGTGGCGGTGGCTAAGATATCTTTGGTATGGGTAAATCAAATGTTAAAGTTTTTGGTATTGATTCTAAGGTAACAACCAGATTTAAAGATGTTGCTGGCCAAGATGAAGCTAAATAAGAAATTTAAGAATTTGTTGATTTCTTGAAAAAACCTGCTAAGTATAAAGCTATCGGTGCTAAGCTTCCTAAGGGTGCTCTCTTGACTGGTCCACCTGGTACTGGTAAAACTCTTCTTGCTAAAGCTTGTGCTGGTGAAGCAGGAGTTCCTTTCTTTTTCATTTCAGGTTCTGATTTCGTTGAAATGTTCGTCGGTGTTGGTGCTTCTCGTGTGAGAGATTTATTCAAATAAGCTAAGCAATAATCACCATCTATTATCTTTATTGATGAAATCGATGCTGTTGGTCGTAAGAGAGAAAACAAGATGGGTGGTAATGATGAAAGAGATAACACCTTAAATCAACTTTTGGTTGAAATGGATGGTTTCGGTACTGATGCAAATGTCATAGTCCTTGCTGCTACAAATAGAAAAGAATTACTTGATCCTGCCCTTACTCGTCCAGGTCGTTTCGATAGAACTATTGAAGTAACAAATCCCGATATTGATGGTCGTAAATAGATTTTCATGGTCCACTTAAAACCCTTGAAGCTTCATCCTTCTAAAACTATGGAAGAATATGCTAAACGTCTTGCTACTCTTACTCCTGGTTTTAGTGGTGCTGACATTATGAATTTATGTAATGAAGCTGCTATCATGGCTGCTAGAAAAAATAAAAAATTTATTGAATCAATTGACTTTGAATTAGCTTCTGAAAGAGTTATTGCTGGTTTAGAAAAGAAGAGAATTGTTTCAGAAGAAGAAAGAAAAATTGTTGCTGTTCATGAATCAGGTCATGCTGTAACATCATGGTTCTTAGAAGGTGGTCATCCTTTACTTAAACTTACAATCATACCAAGAACAAAGGGTTCTTTAGGTTTTGCTTAGTATTTACCAAACGAAAGCAGTCTTGAATCAAAAGAAGAATTATTAGATAGATTATGCACTATCCTTGGTGGTAGATGTGCTGAAGAAGAGTTCTTTGGTAAGATCACTACTGGTGCTTATGATGATTTGAAAAGAGCCTATGAATTATGTCATGCTCTTGTAACAAAATACGGTATGAGTGAAAAGCTTGGTTATGTAGGTTACATTGAAAACGATTACAGCAAGACTTATTCTGATTAGACAAATACATTAATTGATGAGGAAATTAAGAGACTGATTGACGAAGCTACCTAAAGAACAAGAGATCTCATTAAGAAATATAGATCTTAAATCGAAGGGTTATCAAGTGCTTTGTTAGAAAAGGAAACATTAGATTTGAGATAAATTTCAACTATTTTGGGTGAAAGACCTTTCCCTCCCAAGTCAAATTACAAAGCTTATTTAGAATTATAAGTTTAAGATGATGCCGAAAAGGTGCAAGAGTAGGCTGAATCCACTATTGAGGGTGAATCAAACACTCATGAAAATAAAGAAAAGGAAAATGCCTCAGCTGAAAAAGCTTCTCAATGA