TTHERM_00419850

Length: 1017 bp

cDNA Sequence

ATGAAGAAAAGAAAACATTTAGAAAATCAAACAGTTTAGAAAATTACTTTCAAGTTCGCCGCTTTAGCTCAGTGGTTAGAGCATTCGCCTAGTAAGCGAAAGGTCGGCGGTTCAATCCCGCCAAGTGGCTCTTCTTTTTTATCTTTTCTCTCAAAAAAATTTATCATAAAATATTTAATTTTTTTTTTGAATAGAAAAAAGCAAGATATATTAGTTATTTTTAACAAGTAAATTGAATTTCCTTGTAATTTAGAAGAAGTAATAATTAAATAAGAAGAAAAAAATTTTCAAAGAATAGCTACTATGACTTCAAATATTGTTAAAGCATTTTAGGGTTTAAATAATTTGACTTTGAAGATGAATTCCTCATTGTTCAATAAGCAATAATATTTTGCTACAAAGATGCAAGCTAGTTCTACATAAAATGGTAGAGACTCAATTGGTAGAAGATTAGGTATCAAAAAGTTTGGTGGTGAAGAAGTATTCCCCGATGATATTCTTGCTAGATAAAGAGGTTTTAAATGGCACGCAGGTCAAAATACCTATGTTGGTAAGGACCACACAATTCACTCTAAAGTCGAAGGTCATGTTAGATTTGAAAAAAAATACACTGATACTAACAGAAAGGTTGTCACTGTTCATGTTGAACCTGGCTAAGTAAGAAATTAATATAATCGTCCTCCTCCTCCATTTGTTTACCATCCTGAACTCTATCCTGAAAGAGCAGTTAACAACCCAGCTCCAACAAACTTTTAGGTTTATAAACAAACTGTTTAAAAGGTTAAAAGAACTGATTTTAGAGGTTCTAAGGTTGAAAACGCAAATAGAAATGTTGTTTAAATTCCATAGGCTTATTTAGAATAATAAAATCACTGGGAAGTTAAATAAGATAATGGATAAAATATTATTCAAGCTATGCAAAAACTTGAAAGTAAATTATTAGGAATCTAATATGAACCTATTATTGAAGATGTTTAAGGAGAATAAGAAGTTGAAGTATCTCAACAATCTAAGTGA