TTHERM_00420290

Length: 2622 bp

cDNA Sequence

ATGTTTATAAGAAGAGAACTCAAACAAAAATTGCAAACAAAAAGAAAGAAAAAGAAAGATTTTAAAGATATACTTATCTAAAACACAAAAAAGGATACGAATTTAAAAATTGCTAGCATGATAGGATAAGTTGTTAATAAAGGTACTTCTAGCGTCTCTTCCTTATTTTAATAGATTAGAAGAGGTTTTAAAGGATTTGACAAAAATCGTTGGGCTACTTCTGCTGAAGTATTCCCTGAAAAGCCATTTAAATATGGTTATGATAAATAACAAAAGATAAAAACTAAGCAAGATAGATAATGGTATGAAGCTCCTGTTGGTGCTATGACAAAAAAAAGATTTTAGACTGCAGATTTCAGAATTTTTGTTTTGGGTATGAGAGGAGTTGATATATTTCAGAGAATAAATAGATTTAAAAAAGATTAACATCCTCAAGATACATATCAAACTGAATTAGAAGAAGCAGCCTAAAAAACCTTAGAAGGTTAAAAAATTGATGTTGAAGAAGAAGTAGTTAAAGTTGAAAAGGATGAAATTTTTGGAGAACAAGGAGCTCCTAAGAGATACTATGATCGTATTTTGTAGAAGGAACTCTATTTTCATCATAGAAATGGAAAACACTTTTTTGAATAAGCTGACAGAAAAATAAGTTTTTTAAATTAGTTTACTCCTTAAATTGAAAAGGTACCAGAACTCGCTGAAACATTGAAGACTATTTTAAAAATTGCAACTGAATCAGAAGGTTCTCCTCTTAAAAGAGCTGGTATTGACTAAGAGTTTATTATTGAAGATGACTTCTACTCTGAAAATGAAGAATGCAAAAAATTATTTGAAGAAATCAAGCAAAAAGTTTCAAACATGAATTATAGACTTTTACCTGACTTATGCTTAGTCCTTTCTTTTAAACTTAGATACAATAAAGATGTTTTTGGAATTTGGGAGAAAATTGAATAAAATTTTATGTAATCTATTCATCACTATCCTGTCATGGAACTTGTTAAAATGAGATATGCCTCTTGTGCTTTGTCCCCTAAATCACTTTCTCGTGACTGTTTAAAGGCTATCCATGATATTGTTTTTACTGAGCTCCATAATGTTCCTTCTGTATTAGATTTGTCTCACCTTCTTTTCGCATTTAGACATATTAACTCTCTTAAATATTATAATTTAATACTCGATGAAATCTGTAGAAGACCTATTAAAACCCTTTAAGAAGCTATAGCTCTTTTGTTTGTATTTTCTCACTCCCTTTTCCCAAATTACAAGAGAAAGGAGATTAGAGAAAAAGATTAAGATTTAAAAGAAAAGCATAAAATTGTTGATCACCTTGCTGATGCTTTAGCTAATAATGCTAAATAAATTTAGGGTGATGATTTTGTAAGAGTTTTAATTGGTTTGAATAACTTATAACTCACTACCTTCAAGGATGTTTTAACTCATATTGAAAGATATATTATTAAGAATATTGATACTCTTGATGCTTTCTAGACTTCAAATGCTTTATACGGTTTCTCTAAAGCAAACAATAATGCTGGTTTTGGATCTGAATAGCTCTATAAAGCACTTTAAAAGGCTGCTGAAAAGCATTGGTCATAATTCTCAAATGCTGATAAAGCCAGAACCTTTTACGCTTTTGCCTTTTAAGATTTGGTAGATCCTGTTTTCAGAAAGAAATTTATTTAACCATGGCTCAATGAAAATTTAGAATCCAACCTATCACATTCAGAATTACATTATGTCGCTTTCTCATTAATGTTTGAACAAAATAAAGTCAAGTAAATTTTGCCTTATAACTTTTTTTAAATTTACAATAATTTAATTGAAGCTGGTTTTTTAATTATTGAGATATGCTTGCATACGAACAGAAATATCGTAGTAAAAGATATGGGTGATTGGCTATGTAAAAATGCTGAAATATGGAAGAAATTTGTGAAAAATATTTGTAAGAATTAATATGTTGTGCCTGTTTTAAACTACTATCCTATAAAGCTTGCTAGATACTACATGCAATCAATTTTCCCCAAGTGGAATTTCGATATTTACAAGCTTGCCTGCTAAGATGCTGAAGCTACCTGGGATGCTAGTAGATAAATAGATTCTATTATGGAAAACAATAAAGAATGGAAATCAATTGGTGTTTTGCTTTAAAACAGATTAGAGTTCAACTCTATTGGTCTTGACAACTTTGAAAATCTTTTGCTTATTGATTGGGCAATTATGCCTCAAAGAGTTGCTATTATGATATAGGGTGCTCGTCAAACTCTTCCAAACGGAAAACCTACACCACTCCATCGCTTAAAACTTTAATTGCTCGAAAATCACAAGTTTGCAGTATTTAACCTCATTTACAAGGATTTCGAAGCCATTAGTCCTGATTAAAAGATCCCATATTTGAAGAAGACCATTGAAGAACTTATTGCTAAGCAAGATACCTATATTAAAGACGTTGAAGAACCTCAACAATGGTTAAGCTTTATGGATAGAATGTAAGAATTAACCTATAGAAATATCATGATTGGTGAAGCAACTAAGGGTGGTGTTATTGATCCTGAAATTTAAGAAGTCCAATTTGATTGGTCGAAACTTTAGAAAGAATTAAAAGAAAGATAAAAATAAGAGTGA