TTHERM_00420540

Length: 1365 bp

cDNA Sequence

ATGATGTGCCTAGTTTGTCTTTATGGATGTGCGGTTAGAGGTCACAAACATTTAGATCATATTGATAAAGTATATGATATTTCAGAATTATTAGATGTAGAATAATTGAAGAAGTGCTTTTTGTAATAAGACCAAACTATTCTAAGGGAAGAAAATATAAATTCTATTCAGCCCGATTAAATAGAATCTAAGATAGAAAAAATAATCGAGGGCTTTTCTCAAGCAGCTAGATCATGTAAAAAAGCATTAATAGAGCAATTACTTTAAAATGAAAATTCTAACACCTAAGACTAACAAAAATTAATTCAGAGCTTTTATATATAGCTTAAATAGTATTAAAATGGCGAAATAGATCATGTTTCTTTAAATGAGATTGCTAAGCTTTTTACTTATTCAATTCAAAATGAACATAAACAAAATTAGATGGAAATCGAAAATGAAAACGAAAATTAATCATCAAAATAAGAAGATAAGGAGAATATTTCTTTCTAAATTTAATAATGCATTAAAGAATTAGAAAGCATATCTCAGCAGACAAGTTAAATATTTTTAGATTTATGCAAAAAATTGGAATCAAACCGAATCTCCAATTATAATGATATTATTGAAAACCATAAATAGAGTATTTAGCAAGCCAGCACTAAATTGAGCTAGTTTAACTTAGTTAAAGTGTAGAATAAGTAGTTAAATTAGTAAAATACATAATTAATTAGCAAAAATGTAAATAATAAATAAAATAGGTATAATGAATTAATTATTAAGCTTATTTAAAATTTTTTATGCACTAGTGATAACCCATACTTCGATTAAACTTTGTATGAATAACTTAATTAATTAGAAACTATGGATAATTTAAAATAATTAGTAATATCAATCAGTTACTTTACTTAGATCATCACTGAATCATTCTTAGCTAATTTAAGCAATAGTTTAGAATAGCTAAAAAAGCTAAAATACTTAAAAATTAACCTCAAGTAAATAAAAAACGTCATTCTTAGGATATAAAGAAGAATCATTCAGATCTTTGCATTCTTTAAAAAATCTCACGAAATTGAAAAGTCTTCGCTTAAGAATAGTGTAAGCATTTTTTAAGATAAGTAGAAGATTTTTAAAAAACTTTAAATATGTGAAAATAATAGAAGCTCAAATCAAATCAGTGAATATTTTTATATGGAGCTAAATGAGACATTGGCACAGTTAAGTAATTTAGAGGAATTAGAGCTAAATTTCTAAAAGTATTAATTTAGTGCATTAAGTGATTACATAGATTTAAAAAATAATATTTAAAAACCATGTGAACTCACACCTATGGTTTAACTAACTGGAGAAGCTGACTCAGCTAAAGAGACTTTTTATAATAATTGA