TTHERM_00424720

Length: 2145 bp

cDNA Sequence

ATGTTTAAATTTACTTAGAAAAGCTTAGCATTTGGAGCTAACAAAGCAAATAATATTTTAAGGGGAATTCAAAATTAAAGATTTGCCACTAAGAAAGTTGTTCCTAGCAATCTTGATTAATATGATGTCATTATTATTGGCTCTAACATGGGAGCAGTACTTGCTCGTCACATAAATGAAATTACAAATGGTAGAAATACTGTTTTCGTGGCCAGTAGCAGCTCAATTAGAGAACAACATCATTTGAGAGTTGCTTACGAATTAGGAAGCTGTAAAAAGGAAAATTTCATTCTCGATACAAAATCAATTATTACTCCTTTTATACCTCACTCTGATGGTGTTAGAGTCAAAGAAATACATCCTGAATCTAATACTGTAGTACTAGAGAATGATCGCACTATTTAATACAAAAGATTAGTTATTTCAACAGGATTACAGAATAATTTTGAAGCAATTCCCGGTCTTAAAGATGCTGTTTATGATTAAGATCATCCTGCATTCTCACCTTATGATGTGACTGGAAAATAAGCTAGTGTTAAAGATCCTTATTATTGGTATAACTTCTATGGTGGAAAATGCATCTTCTACATTCCTAAATTCCCTATTAGAGGAGAAATTTATTTTAACAAATTTTCATTAAAACAAAATAAAGTCCAAGAATATAACTTCTTAGTTGCTTATGACCAATGGGTAGAGAACCAAAAGAATATGAGCTAGAAAATTGATATTGAATTCACAATTGTAAATGCAAACGATTCATTCTCTTAGTACAGCAAATAAGCTGATGAATATTTTAAAGAAGAACTTAAAAAGAGAGGAATTAAGGTTTTGTACAATACTTAAATTGAAAATATTGATAAGCCTAAGAGATAAGTGACTGTTGTTGGAAAAAATGGAGGAAAAACTGTTGAAAAATATGATAATTTATATTCAATTATTCCCACTAAGGGTCATGAATTTTTGTAATAAGCTAATCTCTGTAACGAATAGGGACTACTCAGCGTTGATAGCCACACTCTCTAACACAAGAAATATAAGAACATCTTTGGTTTTGGTGATATTATTGATGTCCCTACAACAAGAAGTTTCTTTGGAACATAAGAATAACTAAATGTAGTGAGACAGAATGTAATTCGTAGTTTACATGGATAAAGCTTAACTGCATAGTACTTTGGTTAATCTAAGACTCCTTTATACATTGGTAAGAATAAACTTACTTTTGTATCTTAAAATTATGATAAACCTTCGAAATTCAGTATGCTTGATAAAGAAGGAAGACACCTTTGCTATTTGAGAAACTTTATTTATAGTCATTTCTATTAGTATATTAACACTGCATATTACAAGTTTGCTATCTGGGGCAAACCATACTTTTTATGGCCTAAGACTTACCACTCCAGCTCCAAAGGAGTTTAAAATGTCTCAGAAACTCATACAGAACACAGTGAAAAAAAGGATGTTAAATAATCTAATAAAACTGGTTAATAATTTGTATACAAACCTTAAGCATAATTTGCTTGTCTTGATGTAATTTCTCCAGAAATTCAAGCTCAATACTTTGTTGTTAAGGACCCTTCTAAAAGTGTTTAGAATATTTTTAAGAATGAACTGAATGAATAGTAAAAGTAAGCAAAAGAATAAGAAGATAGAGTTAAAAAAGCTGAATAAGAATAAAAGAAAAAGGAGTAATAATTGAAGAGAGAGAAGGAAGAAAAGGAGTAGAAAGAAAGAGAAGAAGAATATAGAAAGAAGAAAGAATAGGAAGAACTTGAAAGAAAGAGACAAGAAGAAGAATAAGAAAAGAAGAGATAATTAGAACTTTAAAGATAGAAAGAAGAATAAGAAAGATAGAAAAAAATAGAATAAGAGAGACTTCAATAGGAAGAACAAGAAAAATTAAAAAAACAAGAGTAAGAAAGATTGAGATAATAGCAATTACAAGAAGAAGAAGCTCTTAAGAAATAATAACAACTTGAAAAGGAAAAGCAAGAAGAGTTAGAGAAATAATAAAAGCAATAAGAAGAAGCAGAAGTTGATGCTAAATAAGAAGATGAATAACCATAATAACCAGCTTCAAATCCTTCTAGTGAAAGTGAAAGTCCTAAAAAGAGAAAGGGCAGACCTAAAAAAGAGAAAAAAGAGTGA