TTHERM_00425840

Length: 1206 bp

cDNA Sequence

ATGATTAATAATAATATTCTCTATCTTTGTCTTATTTTGATTGTTTCTGGTACTTTTGCTTTCAAGATCGCTCCTGATCAACAATGTGTTGTAAAACCAGAACACTAATAGAAAGGTTTTGGTTGCTTACCTCAATACTCTCACACTGAGCTGGGTCATGCTTACTAAAAAAATTTCAACTCAAGCGTTGCTAATAACACTGATTTCTAGTCTTTAGATTAATTTGCTTTGACATATTTTACTGAGGATAAATGTACTTACTATTAAGATTTATAAGTAAATGTGATTTATAACGATTCTTATGTTAAATAAGTTATGTATGAAAACTTCACTAGTGCTTTTTAAAATAAAACAGTTAACATTGTAAAATACTCTCCATATCCCGATGGTAATTAACCTGATTACTTATTTTACTCTTAATACTTTGATTGCAAAAGTAGCAAAATTATTCTTCCTAAATTATTTGAGGAGAAAGGAGAATCTTACAATGTGTGTCTTTTCAACGAAGTTAAATACTTAAATAACTCAATTGATTGCAATTTAGCTCACCTTTTTCACTACAGCTCTGAGTAGTTGTTTGGTTTCTTCAACACATCATCATTTTAGGATTTCATTTATGACCACGCTGTACATGTTATTAGCAATTTGAAAGAAGTTGATGCTGACTTTTCTCCTTTTGGATCCAAATAATGGTATTTCACTTTCAACTTTATGCTTTAAATGACATTAGATGTCAAGGAATATGAATCTTTAAATCAAACTCTCAAATTCTTTAACACAGCAGTTCCTAAAGCTTAACTAAATAGATAAATTAGACCTTGGTTTGTTGGAATAGCTTCATACTCTCCTTACGAACTTGACTTAAATGGTGGAATTATTTTAAATGAAGCCTTATATGGATCTTTATATGATAACATAAAAAGCAATCAATTTGATATTCTTATTAGCTCTCATCCCGATCTTTAATAGGCTAAGGTATTTATCAGCAAAGATTATAGAAACTTCTCCTAAGTCAATGACACTAATTCATTAACTGCATTAAGCCAATTTGAAGCTTTTGTTTTGATTTACATTCCATCATAATTAGAAACTCCTGCTATCCTCAATACTTCCTTCGATTCCTTAAGAATTAATTTAGAAGGCAAAGAAATAATTAACATTTCAGCTGCTAAACAATAAACTGGGATTTAGAAAGATATCTATTGA