TTHERM_00429650

Length: 1563 bp

cDNA Sequence

ATGGGAAATACTTTGTAATATATTCCTTACTTTAACAAGAAAGATAACAGCTTTTAAGATAAAAGTTTAGCAGAGCAGATTTCTGGTTTACATACAGACACTGGCAGTGATCAAACTAAAGCAGATTACTTTTTAAAAGATAATCTCAGTCTATCAATTAAGCTTTTAAATAATAAAATTGTTATGGATAAAAAGAATAATTAAATTATTCCTGGAGTTGTTTCTGTTGAGGCTAAGGACTTTGATGCTGATTAAGTCAAAAAAGATAAAGTTAGATATTAACCCTTAGATTTAATTTTTGTTATAGATACATCTGGTTCCATGCAAGGAAAGAAAATTGAGCTGGTAAAGAAATCCATTTTATAGGTCCTTCACATTATTTAAGGAGATGATAGAATTTCACTAGTAGGATTCAATAGCCAAGCTAAAGTATTGTTAGAACTAACTTAACTAACTAAAAATAGTAAAAAAAAAATATAGAAGACAGTTGATGAATTATAAGCTGGAGGAGGGACCTAAATAGGTTTCGGAATGCAAAAAGCTTTTGATATAATTAAAGAAAGAACAAACTCTAAAAATTTAGCTAGCATATTCCTATTATCCGATGGTTAAGATAATTGCGGATTCTCACAAACTTAGCATTTCATGAATCAATCTAAAATAGAATATCCCTTTTGCATAGATTGTTTTGGCTTTGGAGATGATCATGACTCTTTAACTCTAAGTAAAATAAATCAACTTTAACAAGGCACATTCAATTTTATTAGGGATATTTCTCAAATTGATGATGCTTTTACTATTATTTTAGCAGGAATTAAAACATTTGTTGCATAAAATGTTAAAATATCAGTCAATTTTGGTAATACAGAGCTAATGAATGGGATTACTGTATCAAAAACTTATGGTTCAGAGTGGAAAAAAATCTAAGACAAATAATATGAAATTTAATTAAATCATTTAATGGCAGGTAGAAGTAAAGATTTTGTTTTTGAGTTACAAATACCTTAATTTGAAATGAAGCTAACTGACTAATAAAGGTATTAAATAATAGGTAGTGCTAAGATAAAAGCTAACTCCTTAAACTAAGGAAAAAAAAAGATTACTAAAAAAGCTAATTTAATGGTAGAGCTATTTCTCAACACCGAAGTATAGAAGAAAGATTTGGAAAAAGAAGATGATGAAAAAGTGGCTATTAATCACTTTAGAGTAATTGCAGGTGAAGCTATGGGTACAGTTTTAGCACAAGCTGATAAAAATTAATTTGAAAATAGTTAGAGTTTGCTAAATGAAATAATAAACAAAATTAAAAACTCAAAATATAAAAATAATCCTACAATCCTAAATTTGTTGAAAGATTTACATAACTGCTAATAGGCTGCTCAATCAAGCAACTATTCCACTTTCGGTAGAGGTTATGTAATGAACGCTCAACAAGTTACTATTGGTTAATAAGTCGCATGCAATTTCGACTATAAGTATGCTAATAGAGATTATATTTTAGCTGAGTAAAATATGGGTCAAGAACGCTTTAGAAGCATCAATAGACGTTATTAAAATTAATGA