TTHERM_00433450

Length: 630 bp

cDNA Sequence

ATGATTAGAGATTTTGTATTGCAATAAACAACAGAGCCAGAGAAGAAATTTAATTCTACAGTATTAATAGGTAATTGGTATGAAGAGAGATGTGATCCTAACAGAGAACAAAGCAAATTTTATAACGAACGCAAGTTTGCAGATAACAATTACTAGAAATATACACTCTCTGAAGTAAATTCTATCTTAAAAAAAAATAAATTCCAAGACACAAGCAACAGCTGGTTAAATTTCCAAGAAAATAAACCAGAAGTGAAGAATGACCAATTCATCACTATGAATATGCGTCTTACTGAAATAAAACTCCTATCAAATATAATAATATATTTAATCCAATTGATGATATATTCGTTCATTAATAAATAAATAAATATATTAATTACATCGCCCACTCATTCATATTAACAATCAATATATTAAAGATTTTATTTAGTATTTACTTTCGAAATAAAAAGGTAAGAATATAAAAAGCCAAGTGAATAAAAGAGAAATTCTGAACTAAAGCCCTTCATAGTAAAAAAATCACACTTTGACAAGAATCCTCATGAATTGGAAGAATATAGAGAAAAGTGGACTAAATCTGCTCATACTTTTGATAGAATGTACTTGGGAACATAAAAACCTAACTGA