TTHERM_00433610

Length: 1134 bp

cDNA Sequence

ATGGTTCAATTAAGTGATATTTTGAGTTGCCCCGATAACACTGACGCTTTAGCAAATTAAATTATTTCAGGATAAGAATACGATGTCCTCTAGAAGGCAATTTAAAATTTAAGCATTGATGATCAAAAGCTCGTTTTTACTTAAAAGTTCTTAAAGAGCTTGATATCTATGTACTCTAAAATAGACATTAAAAATATGCAGACCATCGGTGAATTTATAGTTAAAACTCTCAAGGACAAAATGTTTTTCGAATACGAAGTATATCAAACTCGTGTTGAATTGAGTAAAGTTTATGAGGGTATGAACCAACCCTATCTTGCAGGTCAAATATTGGCTTAGGTTAATTATGACTCTCCTAAATTACAATTAAGTGTTAAAGAAAAGGTTGATAAATACCTTTCAATTATTACCTTCTTCTTTGAAATGGAAGAATAAACTGCTGCTGAAACTTGGATCAGCAAAGCAGGTAACATCAACTATGATTTAATCGATGATAAATATTACAAATTCAGATACGAGAATTTATTCGCTGTCAACTTGGATTTCCAAAGAAAGTTTTTACCTGCAGCTCAAAAGTATTACTATTTATCAAACTACCCTGACATTGACTTTGAAGAAGCTAATTTGCTCTTAAATGCTGCTTCTCAATGTGCTATTTTGGGTAATGCAGGTCCACTTAGAACTCGTATCCTTGCCACCCTTTATAAAGACGAAAGAATTCAGTCTATTCCTAACTTCGAAATGCTTGAGTTGACTTACATGCAAAGAATAGTTAGCAAGGAGTAAAAGGATAAATTTGCTGGATCTTTGAAAAAGCATCAATTATAAATTTTAAGAGAAAACTTCACAGTCTTAGATGAAGCTATCTTACAACATAACATCACAGCTGTATCTTAGGTTTATGAATCTATCACAATGAAGTCATTATCTCGTTTGGTCTACATCGGAAGAGATATCGTGGAAGTATGCATCCAAACTATGATTGAAGAAAAAAGAATTAATGCCAAGATTGACTAGTTAATTGATACAGTAAGTTTCTAAAGAGATGAAGATATCCCTGTAGATTTTAATGACAGAATTAGCTAATTCTGTGGTAGACTTAATGAATTCTATGAAAAAATTACTGCCAAGTGA