TTHERM_00433850

Length: 1110 bp

cDNA Sequence

ATGAGAAGGATAACTTAATTAAATAGATAGATCGTATCAAATTTCTCTAGCTCCACTGATAGCGTCCTCTTTACTCAAGATAAATTCAAAGCTAAGGTAGTTTTGAACAAACCAAAAGCATTAAACGCATTAGATTTGGCTATGATTAGATAGATTCAAGGCAGAATTGTCCCTTGGACTTAAGAAGGTATTAAGGCTGTATGGATTAATGGAGCAGGCGGAAAAGCTTTCTGTGCAGGTGGTGATATTAAATCTCTTTACGATGCCAAAAAAAGTGGTAAACCCGAAGAACTCCCTATTCTCGATACATTCTTCAGAGAAGAATTCACACTTGATTATGAACTTGCTAACATGAAACCTACTCAAATTGCAGTCATGGACGGTATTGTTATGGGTGGTGGAGTAGGTATTTCAGTCCATGCTCCTATTAAAATTGCAACTGAAAACTCTGTATTTGCTATGCCAGAGGCAAAAATTGCTTTTTTCACTGATGTAGGTGGTGGTTACTTCTTATCTAGATTACGTAGTAACATTGGTTTATATTTGGGTTTAACAGGTGCAAGACTTAAAGGAAAAGAATTAGTTGCAACAGGTGTTGCTAATTACTATGTACCAAGAAATAAACTTGATGCTCTTGAAGAAGAAGTCAAATCAAGCTTAAATTAAAATAGCACACCTAATGATATTAAAAATATTGTTGCAAAATATGCTGAATAGGTTCCTTTAACTTTTTCTAATGAAGAAGAGATCAAGCAACTCTTTAACGGTGAAACCTTTTAATCTATTTATTAAAACATCTAATCTTCAACCTCTGAATTTGGTTAATCAGTAGCTAAGTTGATTAATCAATAGAATGCTATTTCTCTCAGAATCATTTTTGAACAAATTAAAAGAGGTAAAAAACTCAATCTCAAGGAAAACTTTGTCTCAGATTTCCGTTTGACATAAAGATTTACAGAGGATAATGACTTCTTTGAAGGTATTAGAACAGTTTTAATTGATAGATCTGATACTCCTAATTGGACTTATAAATCTCCTTTGGATGTCCCTTAAACTCTAATTGACTAATACTTTGCTCCTCTTCCTTATGAAAAAGAACTAAAAATTTGA