TTHERM_00438880

Length: 924 bp

cDNA Sequence

ATGGGAAAATGTGCCGCTTTTTTATCTGTCTTAATAGATTCTTCTCATTCTCTCTGTAATAATAACATTTATCTAAACGGTTAAACATAATAATGTGGAGTTGTATAATTACCTGGTTCCTAAAATTCAGTTGCTAACCTTCAATTTAACAATTTTGAAGCCACAGTCGTTTTTTCAACTAAATATTTATCTACATCTAGCGATAGCGAGAATTTATGCTTTGGAAATGCTCAATAAGAACAATTATCATTTGTGAAGTAGCTACAATAATAAAGATTGATTTCTTAATAAAGAGTCTACATTACTTTATTCGATAGATACCTTTAATAAGACCCTCCATCTAGCATTATTGGATACATTAACTTAGAAGAACCAAATCCAGACTATATCAAATAAGGTTCTAGCTTTGTAAAGATATTAACTTCTGACAGTCCATTTTTATTTCAATTAAATGGATAAATTACATTTTTTGATTAATTAATTAGCGTCGCAAGCAATAAAATCTAATTAAAATTCCCTAATTAGGTAGATAATTAATTTGACTAAGCTACATGTGACTAGGTATTTAAAATTTTATAATAAAACAATTTTAATGTTATAAAAGATAGTGGTAAGTACTATTTGCTTTATATTTAAGGCTTAGGACCTATTAAAATTGCATTGTAAACTGAAAATAATAATCCTTACATATTATCTATAGACCCTTCTTAATATATTGAAGAAATTATAAAAGGATATTATAGGTTGAGGATCTAATGTGGCAATTCTTTTTGGCTCTCTTAGAGTGTTTTAACTTCATACTATGTTGGATGGGATCTAGAAACTCAAAGTACCTATATTGCAGAAAGAGTTGAAGGTTTAAATCCTTAATATGCAGCTTAAGATGCTTAAAGTTCTTCTAATTTGAGAAGTTTAAATATTTGA