TTHERM_00439030

Length: 3129 bp

cDNA Sequence

ATGGTGATAATAATTATAACAACACCGCAATACTATTATAGAGTAAGTGAAGAAAAGCTAAATACTATTTTGAAATGTGCTTTGCTCATTGTTATAAAAACTTTAAAACATTAATTCAATTAAAATAGCTTCCCTACTTCTCTGTCTTATATTATCTAAGACCAAACTGAGAAGATGGATGAAATTATGATAACACTAAAGGAATGGACAACTTTTGGATAGATTTACGAAGAAGCAAGATAAGAAATAGTGCAAATATGTTTCGCCACTTCTAATTTGAAGAGCAAAATATGCAATAAAAAAAATACAATAAATAACTAAAGCATATTTGTTGGCTTTTATTAATAATCACTAAATGTAATAAGATTTGCAAATTAATTAAATATTTATTTATTTCCTTCAAATTAAAGATGTTCTATGCAATCTTTGAATTTAAAAAAGACCGCCAAATATTCACAATTTTAATATGCAACATAAATCTATGATTTAACGAATATTTATTTAAATAATCCAATAGAATAGCACGAAACTGTAATAGAGACCACTTTGCTTATTCCAGCTGTATTCCAATTTCTATTGAAAGGTGCTTAGCGCTTCACTACTGGCTAATTCTTGGGAAATGAAAAATAAGAACTTTTGAAGCTTTTCCAAGTTTAAGACATTGAATAATATGAAGCTACAGTTAGCAGATTTGTCAATGCTTTAAAACCAATTTGCGACTCAAATTTATTATAGTGTGATGGTGATATATTCTAAATATTCGGACCAAAATTAATTGAATCTAATATAGAAAATTTAAGCAGTTATTATACAAGTAATATAATGATTGATTTGGATCTGCAATATTTTGTTATTGATAAGAAAAGAGCTTGCAATCCAAATAATTTTACTCCTTTCAGTAGATAAGGAGTCAATAATAAGTAAGCAGCACCTTTTCCATTAGAAAAATATGGACTTTTAAATACATCAAATAGCTCTATTTCTTCTTCAAGCAACTCATCTTCTTCAGTTGCAAAAAAGTAAGAGTAAACAAATCCTTAAACTCATTTAGATAGTAAAGCTAAATATGCTTCATAAAGGCTTCTTAATTATGATATGGTAGAATCATTAAGTGAATCTAAATCAATATAAGATTTCAAAGTCTCAAATCTTAATGTTACTTCCCCTTACATAGTTAAATAGTAATCATCACTGAGTAGAGCAGCTGCTACACCAACAAGTAATGCTATGGAAATGTATAACTGGCTACTTTCTAGAAAAAATATTAACAGTTGCTCAACAGGAAGCATTGCTTTAGAACTGAAAAAGAAAATTGAAAATTTGGACGTTTGGCTAGATGATTAAATAAACAAATTAATTGAATTCGAAAATAAGTAGCAATAAGAGTAAAGAAAGGAATAGATTTAATCATTATTTTATAGAATCTTAAACGAGTATTACAATGAGGAGAAATCTGTTAATTTAAATGTTTAAAAAGGTGTTTTAGTTTGTGCTTGCGAATCTGTTTACTTTATCCTTAATGTATCCTATATAGACTTTTAAAAGTTAGTTCATTTTATTGATATTAATTGGTTTGAGTTATGGAAGATTATGGATTTCATCATGAGATTAGATCAAACTATGCCTGTTTCTTTAAAGGCTCACATTCTAGACTTAGAGTTTGTAAAAGCTTATATTTAAGATACAGAATAAGCTAAAAAGCTACTTGATGATCGCTAATAAGGCAGTGCTATTGAGAAATTCTTCAGGAGAGTCTTACACTAGTGTGCTTATACTATTAATCAAGTTTGTAGTGCATTAAAATTAAATGACAAAATAAGTGAAGCTGTATGGAGGATTATGAAACATATTTTAGCCAATTAATCAGATATCCTTCTTGGAAGACATATTGATCAATTAGTGATTTGCTCTATCTATATCATGTGCAAGCTTTTTAAATCTGAAACTATTTTCAAATAGATCTTAAATAAATATGAAGAATTAAATTCTCATAATAAGGCTATGATGAGAGAGCTAATTTATGCAATGCCTATTGCTCCTAACAAGCTAGATACTATAGTATCATACTATAATAATGTTTACCTAGGCTTTGTTAAAGAAGCTGCCGTTTAAATTTATAAAAGTTTAAAGGATGAGTTTTAAATTTCTGAAATATCCTCTCCTTAAAGCAATCATAAATAAAGTAAGAGTGAAATAATTACAAGGAATCCTGCTATAGCAACTCCTATATTTACTTCACCTTTGAAATCAATTCTACCAAATGACGTTCGTAAATCAATTAGTAAATTACCAAGTCATATGACACCTCAAACACAAATGTTGTACGCATACAATGAATCTCCTTTACTAAAAGAAAATCTTGTAAGTAATCAAAACCTCAGAAGTGTTTATTCAAAGAAAATGATTAATTTTGATGCTGAAATAAACCCTACATAAAATCAATAAAACCCCTAATACTAATTTACTAGTAATGCCCAACAATAACTTTCAACAGTAATATAAAATGTAGCTAAAAATGGATAATCATACTATGGTTTCTAAGCCTAAAACACATCAACTTTCTCAAAATATATTAAACCAAATATGGATAGCATAACAGAATCTTAACAAGAAAATCAAACATCCAACTTCATTCCTCATAAATTTAAAAAAGCAACAGAACAATAGTAATAATAACAATAATTACCTTTAATGAAGCGTAATCTGTTTTCTCAAAGGTAGAATACTGAAGGTGATTAATCAGACGTGACCAATAATTCTATAATATCATGTTAGAGTACACCTAGAGTGATATCAAACAACTAAAATAATTCTAATATTCAAATTTAACAACCTCCTTAATCATAGAATCCTGATCATTAATAAAACAACTTGAGTTTCTTAAAAAATTTTACAAAGCAATCATAGTATTAATATAATTAGATAATATCCCCTACCAAACAACCACAATAATTAACTTCCCCTTTCAACTAATAAAAACTTGTATCACCAAATAGTCATTCATAATTACCTTTACAATAAATACCTTAATAAAAAATAACCTCATGGAAAAACCAAACAAAGAATGTCTAAACTTAAATAAAATAATAAACAAATATCCTAGAAGCTTTTAACAAGAAAAAAGTTTGA