TTHERM_00439300

Length: 750 bp

cDNA Sequence

ATGTCAGACGAAGAAAAACTAGATATATTTGATGATAATGAAGGTGAATAACCAGTAGATGCTGTAAACGATTAAGCTTTTGATGACTAGCAAGTAGATGAGTTGTTGGATTTAAATTTAGATGATGCTGAGTTTGATGATCTTGAATTAGAAAAATATGTAGAAGGAAATGATGATAAACCAAGTAAAAGGATTTAAAAAAAAAGAAAGTCTTCTTCTGGTGGAAATAATGTAGAAGCTAAGTAATAAAAACCAAGATCCAGTAAGAAAGAGGAAGAAAGATTAAAAAATGAGCTCGAAATCAAAGAAGAAGTAAAAAAAATAAAAAGTGAGATGAAATAGATTCATTAAAGAGATATAAAAGCTGTAGAAAATAAAAAACCTGCACTCAATAAAATAAAGCACATTGATGAAATAATTTCTAAGCTTAGCAAGTTAGGCGTCTAGAGAGAATTTGTGTAAGATAAAGGAATTGATTATTTAGCTGACTGGCTTGATAAAATTCCAAATGGACCAGAACCAAGTGTCACTTTAAGAAAGAAACTACTTTAATTCATTTTTGAATTAAATGTTACTCGCTCAAATTTGACTGGAATTCGTCTCGGAAAAGTTATCTATAAGATCTCGTCAAAGAGTGAAGTAAAAGAGTTGAGAATATTAGCTAACAAAGTTGTGGAAAAATGGAGTAAAATAATAAATAGCAGAGATAAAAAATATGATGATGAGGATCAGTACGAATACGGAGATTGA