TTHERM_00441940

Length: 1728 bp

cDNA Sequence

ATGAACTTTACTTCCCCACTCAAGTCAAATAAAGCCAATAATCTGTTTGAAAGCCCTTCTTGCTATATGTCTCCATCCGCTTTTGATAAAAAGGGCGATTAAAATACAAATACTTTAAATGTAATTAATGCACCATTCTGCAACTCAATTCAGTAAAATAAGAGTCCTCAAAATTCTTAGTTCAAAACCCCTACAAAGTACTCTGATCGCTTTATTCCCGCAAGAACAGATTCTATTAGTAAAACTCTGTTCGATTTAAAAGATGAAATGATTGTAGAAGAATAACCTGCAAATAGAATGCTTACAGAGTCTCCTTTTCTTTTTTAAGGATCAAGATAATCTCATGCAAATAATTCAAATAGTTAGAGCACAACCATCAATGGATTTTCTAATGGACATACTCTAAATTCTTCTCAATAATTGACAACCCCAAGTAAAAAAGTCAACTTCTTAAGTTAGTAAGATGAAAACACTAAATCTTATAATGAGTTAATTCAAAGAGAACTTTTTGGTAATTACGAAGGATCTAATAATAAAAAGTCCTCAGAGGAACTTTAAAAAACACCCATTCTCAAATTTCACTGGGACTAAAAAAATGCAACTACATCTCCTCTTCTCAACATTTAGCAATCACCATTCTAGATTTCTACCCCAGATGATCGTTCAAAAGAGTAAAAACGTAAAATATCTAAAACACCTTTCAAAGTATTAGATGCTCCTTAACTCTAAGACGATTTTTATGTTGATTTACTAGACTGGAGTTCACAAAATTTGATAGCAGTAGGATTAGGAAAATCTATCTTTATTTGGAATGCTGCCACTGGAAGTGTATAAAAACTCTGTGATAGTAAAGCTTCCAACTTTGGAACTAATATCGAAAATTGCTAAAACTAATCTCAACTATCTTAATACACAAGCTTAAAATGGTCACCTAACGGTAACTAAATTGCACTCGGAAATTACAACGGATAAGTTGAACTTTGGGACTTAACTACCAGACAGCTTATTTCTGAGTTCTCTGCATAAAAAGAAAGAATAGGATGTATTGATTTCAACAACAATAATGTTTTTGCAGCTGGCTCTAAAGATAAAAGCATCCTTATTCAAGATATTCGTGACCCAAAAATTTTAAGAATGGCTAGAGGTCATAAATAAGAAATATGTTAAGTCAAGTGGTCTCCAGATCAACAATATCTTGCTTCAGGAGGTAATGATAACATGGTAGCTATATGGGATATAGCTCGTTCCTATAGCTAAAACATAAATGGCTTTGGTTCGAATGAAATTAGTCCCTACCAAAAACATAATGAACATTAGGCAGCCGTAAGAGCTCTAGCATGGAATCCTCATTAGTATGGAGTATTATTAAGTGGAGGTGGATCAAGAGATTAAACTATAAAAGTATGGAATATAAATACTAATAGTTTACTTGGATCTGTTGAGGTTGGTTCTTAAGTTTGTAAATTACTATTTTCTCCAGATTAGAATGAATTTGTTTGTGCTCATGGATTTGAATATAACAAAGTAACAGTCTGGAAATATCCTACTATGAGCTAAATCGCAGAACTTGAAGGACATTAAAGCAGAGTTCTATTTATGAGCATGGCACCTGATAATCAGACTATTGTTACTGGTGCTGGTGATGAAACTCTTAAATTCTGGAAGATCTTTTAAGGTAGACCTGTTTCTAAATAACAATCATTGCTTAAGCATTCTGATTTAAGGTGA