TTHERM_00442210

Length: 2898 bp

cDNA Sequence

ATGAGTTTAAGCAGCGTTAGATAGTACTTGCAATTATTGTAAGAAAAGGATAATGAGCTAAAAGTTATTGGATTGGAAAAGTTAGTTTCTGTTGTAGAAACCAACTGGGCTGAAATAGCTGATCATCTTGGAGATATTTCTAAAATTGCTTATAATATAAAATATTGTTGCCTTTTAAAATATAACTTTTCTTCTAACAAAATAAATAGTGAAAATTTATATGAAGATGAGTCATTCCCTAAGAGATAGTTGGCCTATTACTTGGCATCTAAGGTATATTTCAATTTAGAAGAATATGAAGATGCCCTAGACTTAGCTTTAGAATCATAAGAATACTTTTAAGTTGATGAAAACACATAATTTGTAGAAGTTTTAGTTAATACTTGCATTAATAAATATATTACTCATAGATAATCTGACTAGACCACAAAGTTAAATCCTAAATATGAATCTATAGTTGAACGTATGTTTGCAAAATGTTAGAGGGATTAAGATTATAAAAGCGGTTTAGGTATTGCAGTAGAAAGTCGTAGAACTGATAAAATTAATGAAATACTCTCCCAATCAGAAGAATCTAAGCGTGGTGAATTAGTGAATTACTTATATGATGTTTGTATTAAATCATTAAACAGCAGAAATTATCGTATTGAAATTATGCAACTCTTGATTTCATTTTACAAAGAAAAACTTGCTTCTCAAGGATTGCTTCCTCATGAATATATTAATTTAAGTTTAAGCTACCACACTTTAGGAAAGTATGAAGAGTGTTCATAATTAATTGATGATCTTCTTGCCAAAAATATACCTCTTGCCTATCAAGTAGCCACAGAAATTAGTGAAACTTAAAATTACAGCTTTATTAAGAAGGTTATTCAAGCTTTACCAATTGAGGAAAGTAACAGCGAAAAGCGTAAAACAGTCATAGATATTTTAGATGGTAGAACATAAAGAGAAATTAACTAAAAAGTTCTTGAACATTTAAATAAAAGTGATCCTCTCTACATCAAGCAAATCCATTCTGCAGTTGACTCAAAGAAATCAGTTGCTCATACTGCTTTGATTCTCTGTAATTCTATTTTGAATGCAGGAACTGGAAACGATTAATTCGTTAAAGATAATATTGATTGGGCTTAAAAAAGTTAATTGTGGGCTAGATTCGCTTCTTTGGCCTCTTTAGGTATGATCCACTCTGGAAAACCTGAATAAGCTAAATAAATTTTTGCAAGTCATCTTCCCAAGGGATAAGCAGGTGGTAACACCGGAGGTGCTCCTAATTACTACAGTAATGGAGGTGCATTATATGGTATAGGTATTATGCACAGTGGTACACGTGATCCCGAAACTATTAGATATTTAACAGATATTATTAAAGACCCTCAATAAAATAAATAAGAACCTATTCTTCATGGTGCTTGTCTTGGGCTTGGTCTTGCAGGTTTGGCTTCTGAAGATGAAACCTTATTCGAAGTTTTGAAGAATGTTTTAATGAACGACAGTGCAGTAACTGGTGAATCTGCAGCACTTGCTATTGGTCTTATCATGGCAGGAACAAATAATGAAAATGCAATTACAGAATTATTGAAGTTCGGTTCTGAAACACAACATGAAAAAATTATTAGAGCAACTGGTCTTGCTCTTGCTTTAGTTTCTTTCGGATAAGAAGAAAATGCTGACGGTGTTATCGAATCACTTCTTACTGATAAAGATTTTATTCTTAGATACGGTGGTGTCTTAACTGTTGGTCTTGCTTATGTTGGTACTTCCAACAATAAAGCTATTAGAAAATTACTTCATTATGCAGTTGATGATGTTGCTGATGATGTCAGAAGAGCAGCTGTTATCGCATTAGGTTTTGTTATGTTTAACTAATATGAACAAATGCCTAAAATTATGAATCTTTTAGCCATGAGTTATAGTCCTCACGTAAGATATGGTACTGCCATTGCTTTAGGTATAGCATGCGCTGGCACTGGATACTAAGAAGCCTTAAATATGATTGAACCAATGCTCACTGACACCACTGACTTTGTAAGATAGGGAGCTATGATTGGTACAGCTCTTATTTTACAATAAGCCAATTAAAACTCTGAACCTAAATTAGAAAAATTCAAAAAGACTCTTTAAAGCGTTTATTCTAAAAAGCACGAAGATATTTTATGTAAGATGGGTGCCATACTTTCATCTGGTATTATTGAGGCTGGTGGAAGAAATTAAGTTGTTAGACTTGCTTCTTAATAAGGTTTCCCTAAATTAGCTAGTTGCGTTGGTATGGTTATTTTCACCAATTTCTGGTACTGGTTCCCTTATGTTAACTTCATTAATTTGAGTTTTGCTCCTTCTGCTTTAATTGGTATTGATTAAACCTTACGTATTCCTACAGACTTCAGCTTTAAAATTAATACAAAGAAGAGCACTTATGATTACCCTGAGCCAATTAAATAAGATGACAACAAAGATAAAAAGGAATTTGAAAAGGTAACTCTTTCAACAACTAACAAGGCTAAGGCCAGAGCTGCTGTCAAAAATAGTAAAATGGAAGAAGAAGTTGCTGGTACAAGTTAAGCTGAAAATAAAGAAAAGGCAGAAGAAAAAACTGAAGAAAAAGAGCCAAATTCTTATATTTAAACAAATCCTGGTAGAGTACTTGAGAAATAAAAGAAATATGTTGAGTTTATAGAGAATCATAGATATCAACCTATTATTAAAGAAAGAAAATTCGGTATTGTATTTTTAAATGATACATAAAATTCAGATGATGCCAGCTACCTTGGAGTTGCTAAAAAATAAGCTGAATAAAAATCTGAAATGGTTCCAGAACAAGCTGTTGGTGACTAAAACGATGATATAGCTCCACCTGAGGACTTCGTCTATGATGAAAACTAATAACTTTTGAATTGA