TTHERM_00442300

Length: 972 bp

cDNA Sequence

TAATAATTCAAGAAAAAGTAAGAAAAAAATCTTGCTCATTTTCAGAAAGAAAAAAGGTTAGAAAAAGTTTATCTTCACACAAAGCTTCACAGCTCATCAAAGAACTCTATTTTTATTAATTTATAGGAAGCAACTTCGTTTCGCGTTAGAATAAAATAAATATTAAACAAGAAAAAAATCCAAAAAGTACGCATTTATCTACCTCAAATAAGCAAAATGGCCTTAGTCAACATCTAAAACATCCAATTTCATAACAACCCTTGCCCTTTTTTGAGTCCCTTTAAACTTGACGTAACCTTCGAATGTATCAAACCTATACCTGATGACATTGAATGGTAATTAATTTATATTGGTTCTGCTAAAGATGAGAAATACGATTAAGTCCTTGATAAATTCAGTATTGGGTCATTAGATTAAGGAGTGCTTTAATTTACCATTGAAACAAATCCACCTGATCACACTAAGATTCCAAACAAAGATGATTTACTTGGTGTAACTGCTATAATTCTAACTGTTTCATACCACAATCAGGAGTTTTTCCGTGTTGGATACTATGTCTACAATCAATACAATGATCAGGAACTTATTATTAATGATCCTCCTTAAATTCTAATTGATAAGGTTGAGCGTAGTATCCTTGATAAATAGCCTCGTATCACTCATTTCAACATAAAATGGGGTACTGAGGATGAAAATAAAGAAACTGACCCTAATACTTTAGCTATCCTCTAACAGTAATTAGCTTAAAATGGAACCATTCCTAATTAACTCATGCAAGAAATGCAATAAGTGAATAGCTAAATGCAATCTTTCTTACCTGATCCTTTTTCTAAGTCATCAGGAATACTCTAAGAGTTAACAACATAAGGATAGACTAACAGCACAAATAGTTTCATGTTTGGTTAAGGGCTAGACATACCTTAAAATAATGCATTCCAACCTACAAATGTATTCAGTTCTAATCCTTACTGA